Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:20217

Ppip5k2 diphosphoinositol pentakisphosphate kinase 2 ( MGI:2142810)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:20217 EMAGE:20217 EMAGE:20217 EMAGE:20217 EMAGE:20217
"Pseudo-wholemount" of euxassay_012441. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_012441_01 euxassay_012441_02 euxassay_012441_03 euxassay_012441_04
EMAGE:20217 EMAGE:20217 EMAGE:20217 EMAGE:20217 EMAGE:20217
euxassay_012441_05 euxassay_012441_06 euxassay_012441_07 euxassay_012441_08 euxassay_012441_09
EMAGE:20217 EMAGE:20217 EMAGE:20217 EMAGE:20217 EMAGE:20217
euxassay_012441_10 euxassay_012441_11 euxassay_012441_12 euxassay_012441_13 euxassay_012441_14
EMAGE:20217 EMAGE:20217 EMAGE:20217 EMAGE:20217 EMAGE:20217
euxassay_012441_15 euxassay_012441_16 euxassay_012441_17 euxassay_012441_18 euxassay_012441_19
EMAGE:20217 EMAGE:20217 EMAGE:20217 EMAGE:20217
euxassay_012441_20 euxassay_012441_21 euxassay_012441_22 euxassay_012441_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:20217Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
20217_wholemount_strong.wlz
20217_wholemount_moderate.wlz
20217_wholemount_weak.wlz
20217_wholemount_possible.wlz
20217_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:20217_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
thymus primordium
moderate moderate
regionalmoderate expression: see section 11 12 weak expression: see section 13 14
sublingual gland primordium
weak weak
regionalweak expression: see section 10 16
submandibular gland primordium
weak weak
regionalweak expression: see section 07 08 09 17 18 19
pancreas
weak weak
regionalweak expression: see section 10 11 14
thyroid gland
weak weak
regionalweak expression: see section 11 14
vibrissa
weak weak
regionalweak expression: see section 05 06 07 08 09 21
hypothalamus mantle layer
moderate moderate
regionalmoderate expression: see section 07 08 09 10 11 12 13 14 15
diencephalon lateral wall mantle layer
moderate moderate
regionalmoderate expression: see section 06 07 08 09 10 11 12 13 14 15 16
telencephalon mantle layer
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23
medulla oblongata alar plate mantle layer
moderate moderate
regionalmoderate expression: see section 07 08 09 10 11 12 13 14 15 16
medulla oblongata basal plate mantle layer
moderate moderate
regionalmoderate expression: see section 06 07 08 09 10 11 12 13 14 15 16
rest of cerebellum mantle layer
moderate moderate
regionalmoderate expression: see section 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19
pons mantle layer
moderate moderate
regionalmoderate expression: see section 06 07 08 09 10 11 12 13 14 15 16
midbrain mantle layer
moderate moderate
regionalmoderate expression: see section 04 05 06 07 08 09 10 11 12 13 14 15 16 not examined expression: see section 03
facial vii ganglion
strong strong
regionalstrong expression: see section 04 05 moderate expression: see section 19
glossopharyngeal ix ganglion
moderate moderate
regionalmoderate expression: see section 07 08 16 17
trigeminal v ganglion
strong strong
regionalstrong expression: see section 03 04 05 06 20 moderate expression: see section 07 08 16 17 18 19 21
vagus x ganglion
weak weak
regionalweak expression: see section 09 16
vestibulocochlear viii ganglion
moderate moderate
regionalmoderate expression: see section 06 07 08 16 17 18
trigeminal v nerve
moderate moderate
regionalmoderate expression: see section 09 16
spinal cord mantle layer
moderate moderate
regionalmoderate expression: see section 10 11 12 13 14 15 16
dorsal root ganglion
moderate moderate
regionalmoderate expression: see section 09 10 11 15 16 17
lens
moderate moderate
regionalmoderate expression: see section 01 23
neural retina
moderate moderate
regionalmoderate expression: see section 01 02 03 21 22 23
nasal cavity olfactory epithelium
moderate moderate
regionalmoderate expression: see section 08 09 10 11 12 13 16 17 weak expression: see section 14 15
vomeronasal organ
weak weak
regionalweak expression: see section 14
stomach
weak weak
regionalweak expression: see section 07 08 09 10
hindgut
weak weak
regionalweak expression: see section 12 13
midgut
weak weak
regionalweak expression: see section 07 08 09 11 12 13 14 15 16 17
lower jaw incisor
moderate moderate
regionalmoderate expression: see section 16 weak expression: see section 11 12 15
lower jaw molar
weak weak
regionalweak expression: see section 07 18
upper jaw incisor
moderate moderate
regionalmoderate expression: see section 16 weak expression: see section 12 15
upper jaw molar
weak weak
regionalweak expression: see section 07 18 19
metanephros
weak weak
regionalweak expression: see section 09 10 11 16 17 18 19 20
male reproductive system
weak weak
regionalweak expression: see section 12
urethra of male
weak weak
regionalweak expression: see section 12 13
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T30474
Entity Detected:Ppip5k2, diphosphoinositol pentakisphosphate kinase 2 ( MGI:2142810)
Sequence:sense strand is shown

>T30474
TCGGATGGAAGATCCCAAATCAGCTGATATTCAGCTTTACCACAGTGAGACCCTGGAACTTATGCTGCGT
AGATGGTCCAAGTTGGAGAAGGATTTTAAAACAAAGAATGGAAGATATGATATTAGCAAGGTCCCTGACA
TATATGACTGCATCAAATATGACGTTCAGCATAACGGTTCCTTGAAGTTAGAAAACACAATGGAACTATA
TAGGCTTTCAAAGGCATTAGCAGATATTGTTATCCCTCAGGAATATGGTATAACTAAAGCTGAAAAACTG
GAGATTGCCAAAGGCTACTGTACTCCACTAGTTAGAAAAATCCGATCAGATCTTCAGAGGACACAAGATG
ATGATACTGTCAATAAACTCCATCCTGTGTATTCTAGAGGTGTTCTGTCTCCTGAGCGGCACGTCCGCAC
CAGATTATATTTTACCAGTGAGAGTCATGTGCATTCTTTACTATCCATTCTTCGGTATGGCGCCTTATGC
GATGACTCAAAGGATGAGCAGTGGAAACGAGCTATGGATTATCTAAACGTCGTCAATGAGCTCAACTACA
TGACGCAGATTGTTATCATGCTCTATGAGGATCCCAACAAGGACCTTTCCTCAGAGGAACGCTTTCATGT
TGAGTTACATTTTAGTCCTGGAGCCAAAGGCTGTGAAGAAGATAAGAATTTGCCATCTGGCTATGGGTAT
AGGCCAGCATCCAGGGAGAATGAAGGCAGAAGGTCTCTTAAAACTGACGATGATGAGCCCCACACTTCTA
AACGAGATGAAGTTGACCGGGCCGTGATGTTGTTTAAACCATTGGTGTCTGAGCCAATTCATATACACAG
GAAATCACCGCTTCCGAGG
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from the plasmid IMAGE:30044788), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 58837. Forward Primer - name:058837_F_IRAV107_d06_AW555814, sequence:TCGGATGGAAGATCCCAA; Reverse Primer - name:058837_R_SP6_IRAV107_d06_AW555814, sequence:ACCTCGGAAGCGGTGATT. The reverse primer contains a 5' extension containing an SP6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using SP6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:20213 same embryo
 EMAGE:20214 same embryo
 EMAGE:20216 same embryo
 EMAGE:20215 same embryo
 EurExpress:euxassay_012441 same experiment
 MGI:4827360 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS