Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:20280

Cxadr coxsackie virus and adenovirus receptor ( MGI:1201679)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:20280 EMAGE:20280 EMAGE:20280 EMAGE:20280 EMAGE:20280
"Pseudo-wholemount" of euxassay_012371. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_012371_01 euxassay_012371_02 euxassay_012371_03 euxassay_012371_04
EMAGE:20280 EMAGE:20280 EMAGE:20280 EMAGE:20280 EMAGE:20280
euxassay_012371_05 euxassay_012371_06 euxassay_012371_07 euxassay_012371_08 euxassay_012371_09
EMAGE:20280 EMAGE:20280 EMAGE:20280 EMAGE:20280 EMAGE:20280
euxassay_012371_10 euxassay_012371_11 euxassay_012371_12 euxassay_012371_13 euxassay_012371_14
EMAGE:20280 EMAGE:20280 EMAGE:20280 EMAGE:20280 EMAGE:20280
euxassay_012371_15 euxassay_012371_16 euxassay_012371_17 euxassay_012371_18 euxassay_012371_19
EMAGE:20280 EMAGE:20280 EMAGE:20280
euxassay_012371_20 euxassay_012371_21 euxassay_012371_22

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:20280Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
20280_wholemount_strong.wlz
20280_wholemount_moderate.wlz
20280_wholemount_weak.wlz
20280_wholemount_possible.wlz
20280_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:20280_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
pleura
moderate moderate
regionalmoderate expression: see section 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21
submandibular gland primordium epithelium
moderate moderate
regionalmoderate expression: see section 08 09 10 15 16 17
pancreas
moderate moderate
regionalmoderate expression: see section 08 09 10 11 12 13 14 15
epidermis
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22
vibrissa
strong strong
regionalstrong expression: see section 04 05 06 18 moderate expression: see section 02 03 07 19 20
diencephalon lateral wall mantle layer
strong strong
regionalstrong expression: see section 08 09 10 11 12 13 14 15 16 17 18 19
diencephalon meninges
strong strong
regionalstrong expression: see section 07 08 09 10 11 12 13 14 15 16 17 18 19
telencephalon mantle layer
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22
telencephalon meninges
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22
medulla oblongata alar plate mantle layer
strong strong
regionalstrong expression: see section 05 06 08 09 10 11 12 13 14 15 16 17 18
medulla oblongata alar plate marginal layer
strong strong
regionalstrong expression: see section 07
medulla oblongata basal plate mantle layer
strong strong
regionalstrong expression: see section 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18
hindbrain meninges
strong strong
regionalstrong expression: see section 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21
rest of cerebellum mantle layer
strong strong
regionalstrong expression: see section 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21
pons mantle layer
strong strong
regionalstrong expression: see section 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21
midbrain meninges
strong strong
regionalstrong expression: see section 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21
midbrain mantle layer
strong strong
regionalstrong expression: see section 08 09 10 11 12 13 14 15 16 17 18 19
facial vii ganglion
moderate moderate
regionalmoderate expression: see section 05 07 weak expression: see section 19
glossopharyngeal ix ganglion
weak weak
regionalweak expression: see section 08
trigeminal v ganglion
moderate moderate
regionalmoderate expression: see section 05 06 07 weak expression: see section 04 08 17 18 19 20 21
vagus x ganglion
weak weak
regionalweak expression: see section 17
vestibulocochlear viii ganglion
moderate moderate
regionalmoderate expression: see section 05 06 weak expression: see section 08 18 19
endolymphatic duct
moderate moderate
regionalmoderate expression: see section 02 03 04 22
cochlea
moderate moderate
regionalmoderate expression: see section 07 08 09 16 17 18
utricle
moderate moderate
regionalmoderate expression: see section 05 06 07 08 18 19 20 21 22
pharyngo-tympanic tube
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 20 21 22
neural retina
strong strong
regionalstrong expression: see section 01 02 03 21 22
anterior naris epithelium
moderate moderate
regionalmoderate expression: see section 09 10 11 12 13 14
external naris epithelium
moderate moderate
regionalmoderate expression: see section 09 14
posterior naris epithelium
moderate moderate
regionalmoderate expression: see section 10 14
nasal cavity epithelium
moderate moderate
regionalmoderate expression: see section 07
nasal cavity olfactory epithelium
moderate moderate
regionalmoderate expression: see section 08 09 10 11 13 14 15 16 17
esophagus epithelium
moderate moderate
regionalmoderate expression: see section 12 13
pharynx epithelium
moderate moderate
regionalmoderate expression: see section 12 13 14
tongue epithelium
moderate moderate
regionalmoderate expression: see section 09 10 11 12 13 14 15
stomach
strong strong
regionalstrong expression: see section 04 05 06 07 08 09 moderate expression: see section 02 03
rectum
strong strong
regionalstrong expression: see section 11
midgut
strong strong
regionalstrong expression: see section 07 08 09 10 11 12 13 14 15 16
lower jaw incisor
moderate moderate
regionalmoderate expression: see section 09 10 13 14 15
lower jaw molar
moderate moderate
regionalmoderate expression: see section 06 07 18
oral epithelium
moderate moderate
regionalmoderate expression: see section 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19
upper jaw incisor
moderate moderate
regionalmoderate expression: see section 09 10 13 14
upper jaw molar
moderate moderate
regionalmoderate expression: see section 06 18
bladder
moderate moderate
regionalmoderate expression: see section 11 12
urogenital mesentery
weak weak
regionalweak expression: see section 03 04 05 06 07 08 09 13 14 15 16 17 18
metanephros
weak weak
regionalweak expression: see section 19
renal cortex
moderate moderate
regionalmoderate expression: see section 06 07 08 09 14 15 16 17
seminiferous cord
weak weak
regionalweak expression: see section 05 06 07 17 18
larynx
moderate moderate
regionalmoderate expression: see section 12 13
left lung
moderate moderate
regionalmoderate expression: see section 04 05 06 07 08 09 10 11 12
right lung
moderate moderate
regionalmoderate expression: see section 12 13 14 15 16 17 18 19 20
trachea
moderate moderate
regionalmoderate expression: see section 13
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T31268
Entity Detected:Cxadr, coxsackie virus and adenovirus receptor ( MGI:1201679)
Sequence:sense strand is shown

>T31268
ACCAGGGACCACTGGACATTGAATGGCTGATATCCCCGTCTGATAACCAGATAGTGGATCAAGTGATCAT
TTTGTATTCTGGAGACAAAATTTATGATAACTACTATCCGGATCTGAAAGGACGGGTACATTTTACGAGT
AACGATGTCAAGTCTGGCGACGCATCTATAAATGTGACCAACCTGCAGCTGTCGGACATTGGCACTTACC
AGTGCAAAGTGAAGAAAGCCCCTGGGGTTGCAAATAAGAAATTCCTGCTGACCGTTCTTGTTAAGCCTTC
AGGTACAAGATGCTTCGTGGATGGATCGGAAGAGATTGGAAATGACTTCAAGCTAAAATGTGAACCCAAG
GAAGGCTCCCTTCCACTACAGTTTGAATGGCAGAAACTGTCGGACTCCCAGACAATGCCTACGCCATGGC
TGGCAGAAATGACGTCACCAGTTATATCTGTGAAGAACGCCAGTTCTGAGTATTCTGGGACATACAGCTG
CACGGTTCAAAACAGAGTGGGCTCTGACCAGTGTATGCTGCGACTAGACGTTGTCCCACCCTCCAACCGA
GCCGGAACGATCGCGGGCGCCGTCATAGGGACGCTGCTGGCCCTTGTGCTCATCGGGGCCATCCTCTTCT
GCTGTCACAGGAAACGCAGAGAAGAGAAGTACGAGAAGGAAGTTCATCATGATATCAGGGAAGATGTGCC
TCCTCCAAAGAGTCGGACATCCACTGCCAGGAGCTATATTGGCAGCAACCATTCCTCCCTGGGATCCATG
TCCCCCTCTAACATGGAGGGGTATTCCAAGACGCAGTATAACCAAGTCCCCAGTGAAGACTTTGAACGTG
CGC
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from the plasmid IMAGE:4216727), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 54243. Forward Primer - name:054243_F_IRAV49_g01_Cxadr, sequence:ACCAGGGACCACTGGACA; Reverse Primer - name:054243_R_SP6_IRAV49_g01_Cxadr, sequence:GGCGCACGTTCAAAGTCT. The reverse primer contains a 5' extension containing an SP6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using SP6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:20278 same embryo
 EMAGE:20276 same embryo
 EMAGE:20277 same embryo
 EMAGE:20279 same embryo
 EurExpress:euxassay_012371 same experiment
 MGI:4824130 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS