Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:20363

Plekhg3 pleckstrin homology domain containing, family G (with RhoGef domain) member 3 ( MGI:2388284)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:20363 EMAGE:20363 EMAGE:20363 EMAGE:20363 EMAGE:20363
"Pseudo-wholemount" of euxassay_012611. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_012611_01 euxassay_012611_02 euxassay_012611_03 euxassay_012611_04
EMAGE:20363 EMAGE:20363 EMAGE:20363 EMAGE:20363 EMAGE:20363
euxassay_012611_05 euxassay_012611_06 euxassay_012611_07 euxassay_012611_08 euxassay_012611_09
EMAGE:20363 EMAGE:20363 EMAGE:20363 EMAGE:20363 EMAGE:20363
euxassay_012611_10 euxassay_012611_11 euxassay_012611_12 euxassay_012611_13 euxassay_012611_14
EMAGE:20363 EMAGE:20363 EMAGE:20363 EMAGE:20363 EMAGE:20363
euxassay_012611_15 euxassay_012611_16 euxassay_012611_17 euxassay_012611_18 euxassay_012611_19
EMAGE:20363 EMAGE:20363 EMAGE:20363 EMAGE:20363
euxassay_012611_20 euxassay_012611_21 euxassay_012611_22 euxassay_012611_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:20363Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
20363_wholemount_strong.wlz
20363_wholemount_moderate.wlz
20363_wholemount_weak.wlz
20363_wholemount_possible.wlz
20363_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:20363_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
thymus primordium
weak weak
regionalweak expression: see section 11 12 13 14
submandibular gland primordium
weak weak
regionalweak expression: see section 06 07 08 09 17 18 19
pancreas
weak weak
regionalweak expression: see section 06 07 08 09
thyroid gland
weak weak
regionalweak expression: see section 11
vibrissa
moderate moderate
regionalmoderate expression: see section 06 21 22 weak expression: see section 04 05 07 08 20
lateral ventricle choroid plexus
weak weak
regionalweak expression: see section 07 08 09 10 11 12 13 14 15 16 17 18 19
metencephalon part of 4th ventricle choroid plexus
weak weak
regionalweak expression: see section 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21
pharyngo-tympanic tube
weak weak
regionalweak expression: see section 01 02 03 04 20 21 22 23
cornea epithelium
weak weak
regionalweak expression: see section 03 04 23
naris
moderate moderate
regionalmoderate expression: see section 12 13 15 16
nasal cavity olfactory epithelium
moderate moderate
regionalmoderate expression: see section 09 10 11 12 13 15 16 18 weak expression: see section 17 19
aorta
weak weak
regionalweak expression: see section 10 11 12 13 14 15
esophagus
weak weak
regionalweak expression: see section 12 13 14
stomach
weak weak
regionalweak expression: see section 01 02 03 04 05 06 07 08
rectum
weak weak
regionalweak expression: see section 12 13
midgut
moderate moderate
regionalmoderate expression: see section 10 11 12 13 14 15 16 17 weak expression: see section 07 08 09 18
lower jaw incisor
moderate moderate
regionalmoderate expression: see section 11 12 15 16 weak expression: see section 17
lower jaw molar
moderate moderate
regionalmoderate expression: see section 19 weak expression: see section 08
upper jaw incisor
moderate moderate
regionalmoderate expression: see section 12 15 16 weak expression: see section 11
upper jaw molar
moderate moderate
regionalmoderate expression: see section 19 weak expression: see section 07
bladder
weak weak
regionalweak expression: see section 12 13 14 15
metanephros
weak weak
regionalweak expression: see section 06 07 08 15 16 17
male reproductive system
weak weak
regionalweak expression: see section 12 13
urethra of male
moderate moderate
regionalmoderate expression: see section 12 13 14
larynx
weak weak
regionalweak expression: see section 12 13 14
lung
moderate moderate
regionalmoderate expression: see section 03 04 05 06 07 08 09 10 14 15 16 19 20 21 22 weak expression: see section 13 17 18
trachea
weak weak
regionalweak expression: see section 12 13
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T31589
Entity Detected:Plekhg3, pleckstrin homology domain containing, family G (with RhoGef domain) member 3 ( MGI:2388284)
Sequence:sense strand is shown

>T31589
TCCAGGTCCCAGGACAGACAAAGGGGACCCAGCTCCTATCACAGATGCTGAGTTCCGTCCATCTTCAGAA
ATTGCAAAGATATGGGAAAGAATGGAGTCTTCAGAGAGAAGTCCACGGACAGGGTCTGGCCAGAGCCAGG
CCAATGGCTTTGAGCTACAAGAGCCACTGTTCATCTTGGAGGAGCATGAACTGGGGGCCATCACTGAGGA
GTCTGCTGTCGCCTCTCCAGAAAGTGCCTCCCCCACCGAGCAACCCAGCCCAGCCCACCTGGCCCGGGAG
CTCAAAGAGCTGGTGAAAGAGCTGAGCAGCAGTGTCCAGGGGGAGCTGGTTACCCCACTGCACCCCCGGA
TTGTGCAGCTCTCCCATGTGATGGACAGCCATGTGAGTGAGCGGGTCAAAAACAAGGTCTACCAGTTGGC
CCGCCAGTACAGCCTCCGAATTAAGAACATCAAGGCAGCTAGGCCACCTCTACAGTGGGAAAAAGTCACT
CCTGACCAAGAGGAGCAGGTCCCTTCCATTTCTGGCCTGCCTGAGGAAGCTGGAGAGCTGTCAGGGGGCA
AAGCCAGGAGGAAGCCTGTGCTATCCCTCCTCAGCTATGAGCAGCTGGTGGCTCAGGAGCATGGCACGTC
CAAGTCTTCCGCTGCCGTGGAAACCTCTCCACGCCGTTTCTCCTTCAGCCCTTCTGCTGTTAGCCCAAGA
ACCACCTCACCTGGGGCTCGGTCCTCTGCTCGGAGCCCCCTCAGCCCCTTTGACACCGAGACCTTCAATT
GGCCTGATGTCCGGGAGCTCTGCTCCAAATATACTTCCCACGACAAGACTGCTCAGGTCGAGAGCAGCTG
GCCCCGTAGCCTGCTGGTCAACAGGAGTCGCTCCCTGCCCGAGAACATCGTAGAACCTCCCATGTCTGGC
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from the plasmid IMAGE:4971548), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 60791. Forward Primer - name:060791_F_IRAV75_f09_BC030417, sequence:TCCAGGTCCCAGGACAGA; Reverse Primer - name:060791_R_SP6_IRAV75_f09_BC030417, sequence:TGCCAGACATGGGAGGTT. The reverse primer contains a 5' extension containing an SP6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using SP6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:20361 same embryo
 EMAGE:20359 same embryo
 EMAGE:20360 same embryo
 EMAGE:20358 same embryo
 EMAGE:20362 same embryo
 EurExpress:euxassay_012611 same experiment
 MGI:4827270 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS