Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:20443

F3 coagulation factor III ( MGI:88381)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:20443 EMAGE:20443 EMAGE:20443 EMAGE:20443 EMAGE:20443
"Pseudo-wholemount" of euxassay_009157. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_009157_01 euxassay_009157_02 euxassay_009157_03 euxassay_009157_04
EMAGE:20443 EMAGE:20443 EMAGE:20443 EMAGE:20443 EMAGE:20443
euxassay_009157_05 euxassay_009157_06 euxassay_009157_07 euxassay_009157_08 euxassay_009157_09
EMAGE:20443 EMAGE:20443 EMAGE:20443 EMAGE:20443 EMAGE:20443
euxassay_009157_10 euxassay_009157_11 euxassay_009157_12 euxassay_009157_13 euxassay_009157_14
EMAGE:20443 EMAGE:20443 EMAGE:20443 EMAGE:20443 EMAGE:20443
euxassay_009157_15 euxassay_009157_16 euxassay_009157_17 euxassay_009157_18 euxassay_009157_19
EMAGE:20443 EMAGE:20443 EMAGE:20443 EMAGE:20443 EMAGE:20443
euxassay_009157_20 euxassay_009157_21 euxassay_009157_22 euxassay_009157_23 euxassay_009157_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:20443Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
20443_wholemount_strong.wlz
20443_wholemount_moderate.wlz
20443_wholemount_weak.wlz
20443_wholemount_possible.wlz
20443_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:20443_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
axial musculature
strong strong
regionalstrong expression: see section 04 05 06 07 08 21 22 moderate expression: see section 23 24
vibrissa
strong strong
regionalstrong expression: see section 04 moderate expression: see section 02 03 05 20 21
diencephalon lateral wall ventricular layer
moderate moderate
regionalmoderate expression: see section 11 12 13 14 15
telencephalon ventricular layer
moderate moderate
regionalmoderate expression: see section 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22
medulla oblongata alar plate ventricular layer
moderate moderate
regionalmoderate expression: see section 11 12 13 14 15 18 19
medulla oblongata basal plate ventricular layer
moderate moderate
regionalmoderate expression: see section 11 12 13 14 15
pons ventricular layer
moderate moderate
regionalmoderate expression: see section 09 10 13 14 15 16 17 18 19 20
midbrain ventricular layer
moderate moderate
regionalmoderate expression: see section 09 10 11 12 13 14 15 16 17
spinal cord ventricular layer
moderate moderate
regionalmoderate expression: see section 14 15
pharyngo-tympanic tube
strong strong
regionalstrong expression: see section 04 05 06 07 08 09 10 14 15 16 17 18 19 20 21 22 moderate expression: see section 01 02 03 23 24
cornea epithelium
strong strong
regionalstrong expression: see section 01 02 03 21 22 23 24
nasal cavity olfactory epithelium
strong strong
regionalstrong expression: see section 07 08 09 10 11 13 14 15 16 17
esophagus epithelium
strong strong
regionalstrong expression: see section 13 14
pharynx epithelium
strong strong
regionalstrong expression: see section 12 13 14 15
stomach pyloric region
strong strong
regionalstrong expression: see section 07 08 09 10 11 12
rectum
strong strong
regionalstrong expression: see section 13
midgut
strong strong
regionalstrong expression: see section 11 12 13 14 15 16 17 18 19 20
oral epithelium
strong strong
regionalstrong expression: see section 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20
kidney calyx
strong strong
regionalstrong expression: see section 09 10 11 17 18 19 20 21
kidney pelvis
strong strong
regionalstrong expression: see section 18 19
larynx
strong strong
regionalstrong expression: see section 13 14
left lung
moderate moderate
regionalmoderate expression: see section 05 06 07 08 09 10 11 12 13
right lung
moderate moderate
regionalmoderate expression: see section 14 15 16 17 18 19 20 21 22 23 24
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T2420
Entity Detected:F3, coagulation factor III ( MGI:88381)
Sequence:sense strand is shown

>T2420
TGGCCTCGAGGCCAGATTCGGCACGAGGTCGATCTAGAAACTGGAAAAACAAGTGCTTCTCGACCACAGA
CACCGAGTGCGACCTCACAGACGAGATCGTGAAGGATGTGACCTGGGCCTATGAAGCAAAGGTCCTCTCT
GTCCCACGGAGGAACTCAGTTCATGGAGACGGAGACCAACTTGTGATTCATGGGGAGGAGCCGCCATTTA
CAAACGCCCCAAAGTTTTTACCTTACCGAGACACAAACCTCGGACAGCCAGTAATTCAGCAGTTTGAACA
AGATGGTAGAAAACTGAACGTGGTTGTAAAAGACTCACTTACATTAGTCAGAAAGAATGGTACATTCCTC
ACCCTGCGGCAAGTCTTTGGCAAGGACTTGGGTTATATAATTACTTATCGGAAAGGCTCAAGCACGGGAA
AGAAAACAAACATTACAAACACCAATGAATTCTCGATTGATGTGGAAGAAGGAGTAAGCTACTGCTTTTT
TGTACAAGCTATGATTTTCTCCAGGAAAACTAACCAAAATAGCCCAGGA
Notes:The probe template was PCR amplified from IMAGE:1230698 using vector specific primers. Forward Primer - name:RZPD M13 forward, sequence:GCTATTACGCCAGCTGGCGAAAGGGGGATGTG; Reverse Primer - name:RZPD M13 reverse, sequence:CCCCAGGCTTTACACTTTATGCTTCCGGCTCG. Anti-sense probe was then transcribed from the PCR amplified template using T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:1230698 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:20441 same embryo
 EMAGE:20445 same embryo
 EMAGE:20440 same embryo
 EMAGE:20442 same embryo
 EMAGE:20444 same embryo
 EurExpress:euxassay_009157 same experiment
 MGI:4824665 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS