Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:20508

Pcdh20 protocadherin 20 ( MGI:2443376)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:20508 EMAGE:20508 EMAGE:20508 EMAGE:20508 EMAGE:20508
"Pseudo-wholemount" of euxassay_012748. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_012748_01 euxassay_012748_02 euxassay_012748_03 euxassay_012748_04
EMAGE:20508 EMAGE:20508 EMAGE:20508 EMAGE:20508 EMAGE:20508
euxassay_012748_05 euxassay_012748_06 euxassay_012748_07 euxassay_012748_08 euxassay_012748_09
EMAGE:20508 EMAGE:20508 EMAGE:20508 EMAGE:20508 EMAGE:20508
euxassay_012748_10 euxassay_012748_11 euxassay_012748_12 euxassay_012748_13 euxassay_012748_14
EMAGE:20508 EMAGE:20508 EMAGE:20508 EMAGE:20508 EMAGE:20508
euxassay_012748_15 euxassay_012748_16 euxassay_012748_17 euxassay_012748_18 euxassay_012748_19
EMAGE:20508 EMAGE:20508
euxassay_012748_20 euxassay_012748_21

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:20508Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
20508_wholemount_strong.wlz
20508_wholemount_moderate.wlz
20508_wholemount_weak.wlz
20508_wholemount_possible.wlz
20508_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:20508_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
sublingual gland primordium
strong strong
regionalstrong expression: see section 13 15 moderate expression: see section 14
vibrissa
strong strong
regionalstrong expression: see section 03 04 05 18 19 20 21
diencephalon lateral wall mantle layer
weak weak
regionalweak expression: see section 06 08 09 10 11 12 13 14 15 16
diencephalon lateral wall marginal layer
weak weak
regionalweak expression: see section 07
telencephalon mantle layer
weak weak
regionalweak expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21
medulla oblongata alar plate mantle layer
weak weak
regionalweak expression: see section 05 06 07 08 09 10 11 12 13 14 15
medulla oblongata basal plate mantle layer
weak weak
regionalweak expression: see section 05 06 07 08 09 10 11 12 13 14 15
rest of cerebellum mantle layer
weak weak
regionalweak expression: see section 06 07 08 09 10 11 12 13 14 15 16
rest of cerebellum marginal layer
weak weak
regionalweak expression: see section 05
pons mantle layer
weak weak
regionalweak expression: see section 05 06 07 08 09 10 11 12 13 14 15 16
midbrain mantle layer
weak weak
regionalweak expression: see section 05 06 07 08 09 10 11 12 13 14 15 16
spinal cord mantle layer
weak weak
regionalweak expression: see section 09 10 11 12 13
endolymphatic duct
strong strong
regionalstrong expression: see section 01 02 03 18 19 20 21
cochlea
strong strong
regionalstrong expression: see section 06 07 08 14 15 16 17
utricle
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 16 17 18 19 20
nasal cavity
strong strong
regionalstrong expression: see section 09 11 12 15
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T38230
Entity Detected:Pcdh20, protocadherin 20 ( MGI:2443376)
Sequence:sense strand is shown

>T38230
ATCAGTGTAACAGATGCCGATGCTGGAAGGAACGGATGGGTAGCCCTGTCCGTAATGAACCAGAGTGACA
TTTTTGTCATAGACACAGGCAAGGGTATGTTGAGAGCTAAAGTCTCTTTAGACAGAGAACAGCAAAGCTC
TTACACTCTGTGGGTGGAGGCTGTTGACGGGGGTGGGCCTGCCCTTTCCTCTACCACAAAAATCACAATT
CTTCTTCTGGACATCAACGATAACCCTCCTCTTGTTTTATTCCCTCAATCTAATATGTCTTATTTGCTGG
TCCTACCTTCTACTCTCCCTGGCTCACCAGTAACAGAAGTCTATGCGGTTGACAAAGACACAGGCATGAA
TGCTGTCATAGCTTATAGCATCATAGGGAGAAGAGGTCCCAGGCCTGAGTCTTTCAGAATTGACCCCAAG
ACTGGCAACATCACTCTGGAGGAAGCCTTGCTTCAGACAGATTATGGGTTGCATCGCTTACTGGTGAAAG
TGAGTGATCACGGATACCCTGAGCCTCTCCACTCCACAGTCATGGTGAACTTATTTGTCAATGACACTGT
CAGTAACGAGAGCTACATTGAGAGCCTTTTGAGAAAGGAGCCAGAAATTAATATAGAAGAGAAAGAACCA
CAAATCTCAATAGAGCCAACTCATAGGAAGGTAGAATCTATGTCCTGTATGCCCACATTGGTAGCTCTGT
CAGTCATAAGCTTGGGCTCCATCACACTAGTTACAGGGATGGGAATATACATCTGCTTACGGA
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 146561. Forward Primer - name:146561_F_cDNA_Pcdh20, sequence:ATCAGTGTAACAGATGCCGATG; Reverse Primer - name:146561_N_SP6_cDNA_Pcdh20, sequence:TCCGTAAGCAGATGTATATTCCC. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:20505 same embryo
 EMAGE:20506 same embryo
 EMAGE:20507 same embryo
 EMAGE:20503 same embryo
 EMAGE:20504 same embryo
 EMAGE:20509 same embryo
 EurExpress:euxassay_012748 same experiment
 MGI:4827079 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS