Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:20703

Utrn utrophin ( MGI:104631)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:20703 EMAGE:20703 EMAGE:20703 EMAGE:20703 EMAGE:20703
"Pseudo-wholemount" of euxassay_013991. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_013991_01 euxassay_013991_02 euxassay_013991_03 euxassay_013991_04
EMAGE:20703 EMAGE:20703 EMAGE:20703 EMAGE:20703 EMAGE:20703
euxassay_013991_05 euxassay_013991_06 euxassay_013991_07 euxassay_013991_08 euxassay_013991_09
EMAGE:20703 EMAGE:20703 EMAGE:20703 EMAGE:20703 EMAGE:20703
euxassay_013991_10 euxassay_013991_11 euxassay_013991_12 euxassay_013991_13 euxassay_013991_14
EMAGE:20703 EMAGE:20703 EMAGE:20703 EMAGE:20703 EMAGE:20703
euxassay_013991_15 euxassay_013991_16 euxassay_013991_17 euxassay_013991_18 euxassay_013991_19
EMAGE:20703 EMAGE:20703 EMAGE:20703 EMAGE:20703 EMAGE:20703
euxassay_013991_20 euxassay_013991_21 euxassay_013991_22 euxassay_013991_23 euxassay_013991_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:20703Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
20703_wholemount_strong.wlz
20703_wholemount_moderate.wlz
20703_wholemount_weak.wlz
20703_wholemount_possible.wlz
20703_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:20703_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
forelimb digit 1 mesenchyme
strong strong
regionalstrong expression: see section 22
forelimb digit 2 mesenchyme
strong strong
regionalstrong expression: see section 01 20 21 22 23
forelimb digit 3 mesenchyme
strong strong
regionalstrong expression: see section 01 02 20 21 22 23
hindlimb digit 1 mesenchyme
strong strong
regionalstrong expression: see section 01 02 18 19 20
hindlimb digit 2 mesenchyme
strong strong
regionalstrong expression: see section 01 02 17 18 19 20
hindlimb digit 3 mesenchyme
strong strong
regionalstrong expression: see section 01 02 03 16 17 18 19 20
hindlimb digit 4 mesenchyme
strong strong
regionalstrong expression: see section 01 02 03 16 17 18 19 20
hindlimb digit 5 mesenchyme
strong strong
regionalstrong expression: see section 01 02 03 16 17 18 19 20
medulla oblongata alar plate mantle layer
strong strong
regionalstrong expression: see section 11 14
medulla oblongata basal plate mantle layer
strong strong
regionalstrong expression: see section 11 12 13 14
facial vii ganglion
moderate moderate
regionalmoderate expression: see section 05
glossopharyngeal ix ganglion
moderate moderate
regionalmoderate expression: see section 18
trigeminal v ganglion
moderate moderate
regionalmoderate expression: see section 02 03 04 05 06 07 08 17 18 19 20 21 22
dorsal root ganglion
moderate moderate
regionalmoderate expression: see section 09 10 11 12 13 14 15 16 17 18
anterior naris epithelium
moderate moderate
regionalmoderate expression: see section 10 11 13 14
external naris epithelium
moderate moderate
regionalmoderate expression: see section 09
nasal cavity olfactory epithelium
moderate moderate
regionalmoderate expression: see section 07 08 09 10 13 14 15 16 17
stomach
moderate moderate
regionalmoderate expression: see section 03 04 05 06 07 08 09 10
rectum
moderate moderate
regionalmoderate expression: see section 11
midgut
moderate moderate
regionalmoderate expression: see section 08 09 10 11 12 13 14 15 16 17
bladder
moderate moderate
regionalmoderate expression: see section 12
renal cortex
moderate moderate
regionalmoderate expression: see section 07 08 09 16 17 18 19
seminiferous cord
moderate moderate
regionalmoderate expression: see section 05 06 07 19
urethra of male
moderate moderate
regionalmoderate expression: see section 11
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T39501
Entity Detected:Utrn, utrophin ( MGI:104631)
Sequence:sense strand is shown

>T39501
CAGCATTCTGCATTGAGCTACTCACTTGACACTGACCCAGGCCCACAGTTCCACCAGGCAGCATCTGAGG
ACCTGCTGGCCCCACCTCACGACACTAGCACGGACCTCACGGACGTGATGGAGCAGATCAACAGCACGTT
TCCCTCTTGCAGCTCAAATGTCCCCAGCAGGCCACAGGCAATGTGAGCATCTATCCAGCCAGCCAACATT
TCCCGACCTTCAGTATTGCCCTCTTCTGCAAATGCCAATCCCAAGACCCATTCAACCCCAAAGCTCCGTG
GCTCCACGACACAAGCTGTTGAGTGCTTACTGGGTGTTCTACTGAGGGAACCAAACACTGACTATCCAAA
GATATTTTGGTTTTCTAATAACGTATATTATTGTTTTCTTTCTCCCCTTTCTATGCAACTGTAAATTAAT
GAACAGAGAAGTATTTGGAGGTGGTAAAGCATTTGTCACTGATTTGTATAATATATACAGCCATGGGAAA
GTGGGTGGGGGCTTTCTAATATGAAACTGTCTTTTTAATAACCAAGAGAAAAAATTGCATAAGAATTAGA
CCACTTTACATTATTACATTCCTTCTGCTGTTCACATTAACCTTGTACAATAACTTCACTTATTATTTGA
CTGTTTTACCATTATGTTTTGGTTATTTATAAATTTATCAGCCATACCAAACGAATAGATTCTATGTATT
TGGTTTCTATAATCTGGCCAAATTCCTAAGTTCATATATTTGAATCAAATATTTTACATATGTGGAGTAG
GCAGGCATTCTGAAGATACTAT
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 96894. Forward Primer - name:096894_F_cDNA_Utrn, sequence:CAGCATTCTGCATTGAGCTACT; Reverse Primer - name:096894_N_SP6_cDNA_Utrn, sequence:ATAGTATCTTCAGAATGCCTGCC. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:20705 same embryo
 EMAGE:20704 same embryo
 EMAGE:20706 same embryo
 EMAGE:20702 same embryo
 EurExpress:euxassay_013991 same experiment
 MGI:4829139 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS