Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:6859

Shfm1 split hand/foot malformation (ectrodactyly) type 1 ( MGI:109238)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:6859 EMAGE:6859 EMAGE:6859 EMAGE:6859 EMAGE:6859
"Pseudo-wholemount" of euxassay_002665. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_002665_01 euxassay_002665_02 euxassay_002665_03 euxassay_002665_04
EMAGE:6859 EMAGE:6859 EMAGE:6859 EMAGE:6859 EMAGE:6859
euxassay_002665_05 euxassay_002665_06 euxassay_002665_07 euxassay_002665_08 euxassay_002665_09
EMAGE:6859 EMAGE:6859 EMAGE:6859 EMAGE:6859 EMAGE:6859
euxassay_002665_10 euxassay_002665_11 euxassay_002665_12 euxassay_002665_13 euxassay_002665_14
EMAGE:6859 EMAGE:6859 EMAGE:6859 EMAGE:6859 EMAGE:6859
euxassay_002665_15 euxassay_002665_16 euxassay_002665_17 euxassay_002665_18 euxassay_002665_19
EMAGE:6859 EMAGE:6859 EMAGE:6859 EMAGE:6859 EMAGE:6859
euxassay_002665_20 euxassay_002665_21 euxassay_002665_22 euxassay_002665_23 euxassay_002665_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:6859Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
6859_wholemount_strong.wlz
6859_wholemount_moderate.wlz
6859_wholemount_weak.wlz
6859_wholemount_possible.wlz
6859_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:6859_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
olfactory cortex ventricular layer
moderate moderate
homogeneousmoderate expression: see section 14 15
telencephalon ventricular layer
moderate moderate
homogeneousmoderate expression: see section 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23
midbrain ventricular layer
moderate moderate
homogeneousmoderate expression: see section 09 10 11 12 13 14 15 16 17 18
meckel's cartilage
moderate moderate
regionalmoderate expression: see section 03 04 05 06 07 08 09 10 13 14 15 16 17 18 19 20 21 22
lower jaw incisor
moderate moderate
regionalmoderate expression: see section 09 10 13 14
lower jaw molar
moderate moderate
regionalmoderate expression: see section 06 07 08 15 16
upper jaw incisor
moderate moderate
regionalmoderate expression: see section 09 10 13 14
upper jaw molar
moderate moderate
regionalmoderate expression: see section 06 07 08 15 16
orbito-sphenoid
strong strong
regionalstrong expression: see section 01 02 03 04 05 19 20 21 22 23 24
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T5020
Entity Detected:Shfm1, split hand/foot malformation (ectrodactyly) type 1 ( MGI:109238)
Sequence:sense strand is shown

>T5020
GGAGTACTGAGGCTTCCGACTTTGCGGCCGGTCCGAGCAGCTTGGGTCTTGGCGCGGCGCGATGTCTGAA
AAGAAGCAGCCGGTCGACTTGGGTCTCCTGGAAGAGGACGACGAGTTCGAGGAGTTTCCCGCGGAAGACT
GGGCTGGCTTAGATGAAGATGAAGATGCACATGTCTGGGAGGATAATTGGGATGATGACAATGTAGAAGA
TGACTTCTCTAACCAGTTACGTGCTGAGCTGGAGAAGCATGGCTACAAGATGGAGACATCATAGCATCTG
GGAATGTCCCAGGAACCTCAATCATGGACTCTACCACAGTCTAGGACAGAGAAAGCAGGACGGGATACTT
TAAAGAACATGTTTATTTCATTATCTGCTTCAATTTATTTTTGTTTTATAACAAAAAAAATAAGTAAATA
AATGTTTTGATTTAAAAAAAAAAAAAAAA
Notes:The probe template was PCR amplified from IMAGE:5251089 using vector (pCMV-SPORT6) specific primers. Forward Primer - name:RZPD T7, sequence:TAATACGACTCACTATAGGG; Reverse Primer - name:RZPD sp6, sequence:ATTTAGGTGACACTATAG. Anti-sense probe was then transcribed from the PCR amplified template using Sp6 polymerase. EMAGE Editor's Note: the probe sequence indicated here was given by the EURExpress Consortium and has been checked using a computational method whereby a BLAST comparison was made against the full insert sequence of IMAGE:5251089 which was retrieved directly from NCBI.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:6861 same embryo
 EMAGE:6858 same embryo
 EMAGE:6863 same embryo
 EMAGE:6862 same embryo
 EMAGE:6860 same embryo
 EurExpress:euxassay_002665 same experiment
 MGI:4828055 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS