Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:6995

Sgms2 sphingomyelin synthase 2 ( MGI:1921692)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:6995 EMAGE:6995 EMAGE:6995 EMAGE:6995 EMAGE:6995
"Pseudo-wholemount" of euxassay_002377. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_002377_01 euxassay_002377_02 euxassay_002377_03 euxassay_002377_04
EMAGE:6995 EMAGE:6995 EMAGE:6995 EMAGE:6995 EMAGE:6995
euxassay_002377_05 euxassay_002377_06 euxassay_002377_07 euxassay_002377_08 euxassay_002377_09
EMAGE:6995 EMAGE:6995 EMAGE:6995 EMAGE:6995 EMAGE:6995
euxassay_002377_10 euxassay_002377_11 euxassay_002377_12 euxassay_002377_13 euxassay_002377_14
EMAGE:6995 EMAGE:6995 EMAGE:6995 EMAGE:6995 EMAGE:6995
euxassay_002377_15 euxassay_002377_16 euxassay_002377_17 euxassay_002377_18 euxassay_002377_19
EMAGE:6995 EMAGE:6995 EMAGE:6995 EMAGE:6995 EMAGE:6995
euxassay_002377_20 euxassay_002377_21 euxassay_002377_22 euxassay_002377_23 euxassay_002377_24
EMAGE:6995 EMAGE:6995
euxassay_002377_25 euxassay_002377_26

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:6995Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
6995_wholemount_strong.wlz
6995_wholemount_moderate.wlz
6995_wholemount_weak.wlz
6995_wholemount_possible.wlz
6995_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:6995_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
rib
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 19 20 21 22 23 24 25 26
humerus
strong strong
regionalstrong expression: see section 01 02 03
femur
strong strong
regionalstrong expression: see section 04 05 06 10 11 12 19 20 24 25 26
meckel's cartilage
strong strong
regionalstrong expression: see section 03 04 05 06 07 08 09 10 11 16 17 18 19 20 21 22 23 24
lower jaw incisor
strong strong
regionalstrong expression: see section 11 12 15 16 17
lower jaw molar
strong strong
regionalstrong expression: see section 08 09 10 18 19 20 21 22
upper jaw incisor
strong strong
regionalstrong expression: see section 11 12 15 16 17
upper jaw molar
strong strong
regionalstrong expression: see section 09 10 18 19 20 21 22
axial skeleton cervical region
strong strong
regionalstrong expression: see section 09 10 11 12 17 18 19 20
axial skeleton lumbar region
strong strong
regionalstrong expression: see section 18
axial skeleton thoracic region
strong strong
regionalstrong expression: see section 11 12 17 18
cranium
strong strong
regionalstrong expression: see section 01 02 03 04
basioccipital bone
strong strong
regionalstrong expression: see section 12 13 14 15 16 17
basisphenoid bone
strong strong
regionalstrong expression: see section 05 06 22 23
frontal bone primordium
strong strong
regionalstrong expression: see section 25 26
orbito-sphenoid
strong strong
regionalstrong expression: see section 05 06 21 22 23 24 25 26
clavicle
strong strong
regionalstrong expression: see section 07 08 09 10 11 19 20 21 22 24
scapula
strong strong
regionalstrong expression: see section 02 03 04 05 24 25 26
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T1997
Entity Detected:Sgms2, sphingomyelin synthase 2 ( MGI:1921692)
Sequence:sense strand is shown

>T1997
GGCCTCGAGGCCAGCTGTCGTGCTCACACTTNCTTACTTGTTCATCAAAGAATATTCACCTCGTCACTTC
TGGTGGTATCACTTGGTCTGCTGGCTGCTGAGTGCGGCTGGGATCATCTGCATTCTCGTAGCGCATGAAC
ACTATACCGTGGACGTCATCATTGCTTACTATATCACAACACGGCTGTTTTGGTGGTACCATTCCATGGC
CAACGAAAAGAACTTGAAGGTCTCTTCCCAGACGAACTTCTTGTCTCGGGCTTGGTGGTTCCCCATNNTT
CTACTTTTTTGAGAAGAATGTGCAAGGCTCAATTCCTTGCTGCTTTTCCTGGCCGCTGTCCTGGCCCCCT
GGCTGCTTCAAGTCATCGTGCAGAAAGTATTCCCGGGTCCAGAAGATCGGGGAGGATAATGAGAAGTCTA
CCTGAGCTGCCAACCCGGCAGCCGCTCTCACACCAAAAGAGTCCGTGCTGCAACCGAAGGCACGTGCGGC
TTTATATTTATTTTCAGAGAACTGACTGGTAAAATGAAGTGGACCAAATTTTATGCAAAAGATTGGAGCG
ATGAAGT
Notes:The probe template was PCR amplified from IMAGE:721318 using vector specific primers. Forward Primer - name:RZPD M13 forward, sequence:GCTATTACGCCAGCTGGCGAAAGGGGGATGTG; Reverse Primer - name:RZPD M13 reverse, sequence:CCCCAGGCTTTACACTTTATGCTTCCGGCTCG. Anti-sense probe was then transcribed from the PCR amplified template using T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:721318 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:6996 same embryo
 EMAGE:6997 same embryo
 EMAGE:6999 same embryo
 EMAGE:6994 same embryo
 EMAGE:6998 same embryo
 EurExpress:euxassay_002377 same experiment
 MGI:4828027 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS