Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:7783

Scrg1 scrapie responsive gene 1 ( MGI:1328308)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:7783 EMAGE:7783 EMAGE:7783 EMAGE:7783 EMAGE:7783
"Pseudo-wholemount" of euxassay_007430. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_007430_01 euxassay_007430_02 euxassay_007430_03 euxassay_007430_04
EMAGE:7783 EMAGE:7783 EMAGE:7783 EMAGE:7783 EMAGE:7783
euxassay_007430_05 euxassay_007430_06 euxassay_007430_07 euxassay_007430_08 euxassay_007430_09
EMAGE:7783 EMAGE:7783 EMAGE:7783 EMAGE:7783 EMAGE:7783
euxassay_007430_10 euxassay_007430_11 euxassay_007430_12 euxassay_007430_13 euxassay_007430_14
EMAGE:7783 EMAGE:7783 EMAGE:7783 EMAGE:7783 EMAGE:7783
euxassay_007430_15 euxassay_007430_16 euxassay_007430_17 euxassay_007430_18 euxassay_007430_19
EMAGE:7783 EMAGE:7783 EMAGE:7783 EMAGE:7783 EMAGE:7783
euxassay_007430_20 euxassay_007430_21 euxassay_007430_22 euxassay_007430_23 euxassay_007430_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:7783Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
7783_wholemount_strong.wlz
7783_wholemount_moderate.wlz
7783_wholemount_weak.wlz
7783_wholemount_possible.wlz
7783_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:7783_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
hindlimb digit 1 metatarsal
strong strong
regionalstrong expression: see section 21 moderate expression: see section 05
hindlimb digit 1 phalanx
moderate moderate
regionalmoderate expression: see section 06 19
hindlimb digit 2 metatarsal
strong strong
regionalstrong expression: see section 21 22 moderate expression: see section 04 05
hindlimb digit 2 phalanx
moderate moderate
regionalmoderate expression: see section 06 17 18 19
hindlimb digit 3 metatarsal
strong strong
regionalstrong expression: see section 21 22 moderate expression: see section 04 05
hindlimb digit 3 phalanx
moderate moderate
regionalmoderate expression: see section 06 07 17 18 19
hindlimb digit 4 metatarsal
strong strong
regionalstrong expression: see section 21 moderate expression: see section 04 05
hindlimb digit 4 phalanx
moderate moderate
regionalmoderate expression: see section 07 17 18
hindlimb digit 5 metatarsal
moderate moderate
regionalmoderate expression: see section 04
hindlimb digit 5 phalanx
moderate moderate
regionalmoderate expression: see section 07
glossopharyngeal ix ganglion
moderate moderate
single cellmoderate expression: see section 08 09 20 21
trigeminal v ganglion
moderate moderate
single cellmoderate expression: see section 05 06 07 08 09 10 18 19 20 21 22 23
nasal septum
strong strong
regionalstrong expression: see section 11 12 13 14 15 16
esophagus
moderate moderate
regionalmoderate expression: see section 14 15
left lung
strong strong
spottedstrong expression: see section 06 07 08 09 10 11 12 13 moderate expression: see section 05
right lung
strong strong
spottedstrong expression: see section 14 15 16 17 18 20 21 22 23 24 moderate expression: see section 19
temporal bone
moderate moderate
regionalmoderate expression: see section 04 05 06 21 22 23 24 weak expression: see section 02 03
orbito-sphenoid
moderate moderate
regionalmoderate expression: see section 02 03 04 05 06 07 08 09 17 18 19 20 21 22 23 24
viscerocranium
moderate moderate
regionalExpression in the turbinate bone.
sternum
strong strong
regionalstrong expression: see section 14 15
axial skeleton tail region
strong strong
regionalstrong expression: see section 13 moderate expression: see section 12 14
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T9076
Entity Detected:Scrg1, scrapie responsive gene 1 ( MGI:1328308)
Sequence:sense strand is shown

>T9076
AGCCTCCTCGCTTCTCCTTTGCCCAGACTGCCCCAGTGAGCTGGAGCATTGAAGAAGAGTCTCCTGCCAA
TAACACTGAAAAGAAAGAAAAAGGAGCAAGAGCCATGATGAAATCTGTGGTACTTGTCATCCTTGGGCTA
ACTTTGCTGTTAGAAACACAAGCCATGCCTTCAAGTCGCCTCTCCTGCTACAGAAAGTTGCTAAAGGATC
GCAATTGTCACAACCTTCCGGAGGGCAGAGCCGACCTGAAGCTGATAGATGCAAATGTCCAGCATCATTT
CTGGGATGGGAAGGGATGCGAGATGATCTGCTACTGCAACTTCAGCGAACTGCTCTGCTGCCCAAAAGAT
GTCTTCTTTGGACCAAAGATCTCCTTTGTGATCCCCTGCAACAACCACTGAGGATCTGCCTTGCACTCTG
GAGAACATGGTCCTGAAGGCATCTTTTGGGCAGCAGAGCCGACCTGAAGCTGATAGATGCAAATGTCCAG
CATCATTTCTGGGATGGGAAGGGATGCGAGATGATCTGCTACTGCAACTTCAGCGAACTGCTCTGCTGCC
CAAAAGATGTCTTCTTTGGACCAAAGATCTCCTTTGTGATCCCCTGCAACAACCACTGAGGATCTGCCTT
GCACTCTGGAGAACATGGTCCTGAAGGCCTTCACGTCCCCTAATTTCCCACAAACTCTGTCAGTTCAGCG
CCATTTCTGATATCCATCCAGTATATCCAATCTTGCATAGATTCTATAAAGTCTTACTTGCTAGAGTATA
CTTGGGCTAAAGTGGTAATAAAAGTTGTTTCCATTTGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
Notes:The probe template was PCR amplified from IMAGE:6819318 using vector (pYX-Asc) specific primers. Forward Primer - name:RZPD T3, sequence:ATTAACCCTCACTAAAGGGA; Reverse Primer - name:RZPD T7, sequence:TAATACGACTCACTATAGGG. Anti-sense probe was then transcribed from the PCR amplified template using T7 polymerase. EMAGE Editor's Note: the probe sequence indicated here was given by the EURExpress Consortium and has been checked using a computational method whereby a BLAST comparison was made against the full insert sequence of IMAGE:6819318 which was retrieved directly from NCBI.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:7785 same embryo
 EMAGE:7784 same embryo
 EMAGE:7782 same embryo
 EMAGE:7781 same embryo
 EurExpress:euxassay_007430 same experiment
 MGI:4827910 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS