Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:8151

Pcdh10 protocadherin 10 ( MGI:1338042)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:8151 EMAGE:8151 EMAGE:8151 EMAGE:8151 EMAGE:8151
"Pseudo-wholemount" of euxassay_016446. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_016446_01 euxassay_016446_02 euxassay_016446_03 euxassay_016446_04
EMAGE:8151 EMAGE:8151 EMAGE:8151 EMAGE:8151 EMAGE:8151
euxassay_016446_05 euxassay_016446_06 euxassay_016446_07 euxassay_016446_08 euxassay_016446_09
EMAGE:8151 EMAGE:8151 EMAGE:8151 EMAGE:8151 EMAGE:8151
euxassay_016446_10 euxassay_016446_11 euxassay_016446_12 euxassay_016446_13 euxassay_016446_14
EMAGE:8151 EMAGE:8151 EMAGE:8151 EMAGE:8151 EMAGE:8151
euxassay_016446_15 euxassay_016446_16 euxassay_016446_17 euxassay_016446_18 euxassay_016446_19
EMAGE:8151 EMAGE:8151 EMAGE:8151 EMAGE:8151 EMAGE:8151
euxassay_016446_20 euxassay_016446_21 euxassay_016446_22 euxassay_016446_23 euxassay_016446_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:8151Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
8151_wholemount_strong.wlz
8151_wholemount_moderate.wlz
8151_wholemount_weak.wlz
8151_wholemount_possible.wlz
8151_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:8151_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
rib
weak weak
regionalweak expression: see section 02 03 04 05 19 20 21 22 23 24
diencephalon lateral wall mantle layer
moderate moderate
regionalmoderate expression: see section 11 weak expression: see section 09 10 12 13 14 15 16
cerebral cortex mantle layer
weak weak
regionalweak expression: see section 03 04 10 14 17 18 19 20 24
telencephalon mantle layer
weak weak
regionalweak expression: see section 02 03 04 05 06 07 17 18 19 20 21 22 23 24
medulla oblongata basal plate mantle layer
weak weak
regionalweak expression: see section 07 08 09 15 16
rest of cerebellum mantle layer
moderate moderate
regionalmoderate expression: see section 05 08 10 12 17 weak expression: see section 06 07 09 13 15
pons mantle layer
weak weak
regionalweak expression: see section 07 17
midbrain mantle layer
moderate moderate
regionalmoderate expression: see section 11 weak expression: see section 07 08 09 10 12 13 14 15 16
facial vii ganglion
weak weak
regionalweak expression: see section 04 05 19
glossopharyngeal ix ganglion
weak weak
regionalweak expression: see section 06 07 08 17 18
trigeminal v ganglion
weak weak
regionalweak expression: see section 03 04 05 06 07 08 09 17 18 19 21 22
ventral grey horn
moderate moderate
regionalmoderate expression: see section 13 weak expression: see section 10 11 12 14
dorsal root ganglion
weak weak
regionalweak expression: see section 06 07 08 09 10 14 15 16 17
mandible
weak weak
regionalweak expression: see section 05 06 07 09 19 20 21 22
maxilla
weak weak
regionalweak expression: see section 11 21
bladder
weak weak
regionalweak expression: see section 13 14
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T63344
Entity Detected:Pcdh10, protocadherin 10 ( MGI:1338042)
Sequence:sense strand is shown

>T63344
CACTTATCCTTATCATCGCCCTGGGCTCGGTGTCCTTCATCTTCCTGCTGGCCATGATCGTGTTGGCCGT
GCGCTGTCAGAAAGAGAAAAAACTCAACATCTACACGTGTCTCGCGAGCGATTGCTGCCTCTGCTGCTGC
TGCTGCGGCAATGGGAGCTCCACCTGCTGCGGCCGCCAAGCCCGGGCGCGCAAGAAGAAACTCAGCAAGT
CAGATATCATGTTGGTGCAGAGCGCCAACGTCCCTAGCAACCCGGCCCAGGTGCCGGTAGAGGAGTCCGG
AGGCTTCGGTTCCCATCACCACAATCAGAACTATTGCTATCAGGTCTGCCTCACCCCGGAGTCCGCCAAG
ACCGACCTGATGTTCCTGAAGCCCTGCAGCCCTTCCCGGAGTACAGATGCTGAGCACAATCCCTGCGGAG
CCATCGTCACCGGGTACAGCGACCAGCAACCAGACATCATTTCCAACGGAAGCATTTTGTCCAACGAGGT
AAGGCTGAAGGGAAAGAAGCACCATCTCTCATCTCCTCCATCAGAAAGCCTCCTTTAGCCCGGCCCTGCA
TCTCTTCTGGTGCACTGTGTATTTTCAGGTGTTAGCGTGTTTGTGTGGCTGAGGGAAGGGGAGGATTGGG
GGTCACCTTTTATCACCTCTTGGTGTGTAACCTAACTTCTGTGTTCTGTGTTCTGACTGCACTCCACCCC
TTTGATTTTATTTTCATTCCCCCCTCCCAGCACCCCCCCCCCCCTTTGCTTCTTTGCAACCTTGGAGCTT
CCTCCTCCCTCTTCTACATTTAT
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 96579. Forward Primer - name:096579_F_cDNA_Pcdh10, sequence:CACTTATCCTTATCATCGCCCT; Reverse Primer - name:096579_N_SP6_cDNA_Pcdh10, sequence:ATAAATGTAGAAGAGGGAGGAGG. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:8147 same embryo
 EMAGE:8149 same embryo
 EMAGE:8148 same embryo
 EMAGE:8146 same embryo
 EMAGE:8150 same embryo
 EurExpress:euxassay_016446 same experiment
 MGI:4827077 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS