Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:8562

Notch2 Notch gene homolog 2 (Drosophila) ( MGI:97364)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:8562 EMAGE:8562 EMAGE:8562 EMAGE:8562 EMAGE:8562
"Pseudo-wholemount" of euxassay_009776. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_009776_01 euxassay_009776_02 euxassay_009776_03 euxassay_009776_04
EMAGE:8562 EMAGE:8562 EMAGE:8562 EMAGE:8562 EMAGE:8562
euxassay_009776_05 euxassay_009776_06 euxassay_009776_07 euxassay_009776_08 euxassay_009776_09
EMAGE:8562 EMAGE:8562 EMAGE:8562 EMAGE:8562 EMAGE:8562
euxassay_009776_10 euxassay_009776_11 euxassay_009776_12 euxassay_009776_13 euxassay_009776_14
EMAGE:8562 EMAGE:8562 EMAGE:8562 EMAGE:8562 EMAGE:8562
euxassay_009776_15 euxassay_009776_16 euxassay_009776_17 euxassay_009776_18 euxassay_009776_19
EMAGE:8562 EMAGE:8562 EMAGE:8562 EMAGE:8562 EMAGE:8562
euxassay_009776_20 euxassay_009776_21 euxassay_009776_22 euxassay_009776_23 euxassay_009776_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:8562Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
8562_wholemount_strong.wlz
8562_wholemount_moderate.wlz
8562_wholemount_weak.wlz
8562_wholemount_possible.wlz
8562_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:8562_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
medulla oblongata part of 4th ventricle choroid plexus
strong strong
regionalstrong expression: see section 08 09 10 11 12 13 14 15 16 17 18 19 20
body cavity or lining
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
limb
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
mesenchyme
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
vertebral axis musculature
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
gland
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
alimentary system
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
integumental system
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
diencephalon lateral wall ventricular layer
strong strong
regionalstrong expression: see section 11 12 13 14
diencephalon meninges
strong strong
regionalstrong expression: see section 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21
telencephalon meninges
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22
telencephalon ventricular layer
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
medulla oblongata alar plate ventricular layer
strong strong
regionalstrong expression: see section 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21
medulla oblongata basal plate ventricular layer
strong strong
regionalstrong expression: see section 12 13 14 17 18 19
hindbrain meninges
strong strong
regionalstrong expression: see section 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22
rest of cerebellum ventricular layer
strong strong
regionalstrong expression: see section 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22
pons marginal layer
strong strong
regionalstrong expression: see section 17
pons ventricular layer
strong strong
regionalstrong expression: see section 05 06 07 08 09 10 11 12 13 14 15 16 18 19 20 21 22
metencephalon part of 4th ventricle choroid plexus
strong strong
regionalstrong expression: see section 08 09 10 11 12 13 14 15 16 17 18 19 20
midbrain meninges
strong strong
regionalstrong expression: see section 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21
midbrain ventricular layer
strong strong
regionalstrong expression: see section 07 08 09 10 11 12 13 14 15 16
spinal cord ventricular layer
strong strong
regionalstrong expression: see section 11 12 13 14
spinal cord meninges
strong strong
regionalstrong expression: see section 10 11 12 13 14 15 16 17 18
nasal cavity olfactory epithelium
strong strong
regionalstrong expression: see section 08 09 10 11 12 13 14 15 16 17 18 19 20
vomeronasal organ
strong strong
regionalstrong expression: see section 13 16
cardiovascular system
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
urinary system
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
reproductive system
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
respiratory system
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
skeleton
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
tail
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T30637
Entity Detected:Notch2, Notch gene homolog 2 (Drosophila) ( MGI:97364)
Sequence:sense strand is shown

>T30637
GTTTCTTGCTGCCCGAGAGGGAAGTTATGAAGCGGCCAAAATCCTGTTAGACCATTTTGCCAACCGGGAC
ATCACTGACCACATGGACCGCCTTCCCCGGGATGTGGCTCGGGACCGCATGCACCATGACATCGTTCGCC
TCCTGGACGAGTATAACGTGACTCCCAGCCCTCCGGGAACGGTCTTGACTTCTGCGCTCTCACCTGTCCT
CTGTGGGCCCAACAGGTCTTTCCTCAGTCTGAAGCACACCCCAATGGGTAAGAAGGCTAGGCGGCCCAAC
ACCAAGAGCACCATGCCCACGAGCCTGCCTAACCTTGCCAAGGAGGCCAAGGATGCCAAGGGCAGCAGGA
GGAAGAAGTGTCTGAACGAGAAGGTCCAGCTGTCCGAGAGCTCAGTGACTCTATCCCCCGTCGATTCGCT
CGAGTCTCCTCACACGTATGTCTCCGATGCCACATCCTCTCCCATGATCACATCCCCTGGAATCTTACAG
GCCTCGCCCACCCCCCTGCTGGCTGCTGCCGCCCCGGCTGCCCCAGTGCACACACAGCATGCGCTGTCTT
TCTCTAACCTTCATGACATGCAGCCTTTGGCTCCTGGAGCCAGCACCGTGCTCCCCTCGGTCAGCCAGCT
GCTATCCCACCACCACATCGCGCCCCCAGGTAGTAGCAGTGCAGGAAGCTTGGGCAGGTTACATCCAGTT
CCTGTCCCAGCAGACTGGATGAACCGTGTGGAGATGAACGAGACCCAGTACAGTGAAATGTTTGGCATGG
TCCTGGCTCCTGCAGAGGGAGCCCACCCTGGCATAGCAGCTCCCCAGAGCAGACCTCCGGAAGGGAAGCA
CATGTCCACCCAGCGGGAGCCCTTGCCTCCCATCGTGACTTTCCAGCTTATCCCAAAAGGCAGCATTGCC
CAGGCAGCCGGAGCTCCCCAGACGCAGTCCAGTTGC
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from the plasmid IMAGE:6406444), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 59940. Forward Primer - name:059940_F_IRAV115_h12_Notch2, sequence:GTTTCTTGCTGCCCGAGA; Reverse Primer - name:059940_R_SP6_IRAV115_h12_Notch2, sequence:GGCAACTGGACTGCGTCT. The reverse primer contains a 5' extension containing an SP6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using SP6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:8559 same embryo
 EMAGE:8564 same embryo
 EMAGE:8561 same embryo
 EMAGE:8563 same embryo
 EMAGE:8560 same embryo
 EurExpress:euxassay_009776 same experiment
 MGI:4826753 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS