Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:8789

Hsp90aa1 heat shock protein 90, alpha (cytosolic), class A member 1 ( MGI:96250)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:8789 EMAGE:8789 EMAGE:8789 EMAGE:8789 EMAGE:8789
"Pseudo-wholemount" of euxassay_010007. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_010007_01 euxassay_010007_02 euxassay_010007_03 euxassay_010007_04
EMAGE:8789 EMAGE:8789 EMAGE:8789 EMAGE:8789 EMAGE:8789
euxassay_010007_05 euxassay_010007_06 euxassay_010007_07 euxassay_010007_08 euxassay_010007_09
EMAGE:8789 EMAGE:8789 EMAGE:8789 EMAGE:8789 EMAGE:8789
euxassay_010007_10 euxassay_010007_11 euxassay_010007_12 euxassay_010007_13 euxassay_010007_14
EMAGE:8789 EMAGE:8789 EMAGE:8789 EMAGE:8789 EMAGE:8789
euxassay_010007_15 euxassay_010007_16 euxassay_010007_17 euxassay_010007_18 euxassay_010007_19
EMAGE:8789 EMAGE:8789 EMAGE:8789 EMAGE:8789 EMAGE:8789
euxassay_010007_20 euxassay_010007_21 euxassay_010007_22 euxassay_010007_23 euxassay_010007_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:8789Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
8789_wholemount_strong.wlz
8789_wholemount_moderate.wlz
8789_wholemount_weak.wlz
8789_wholemount_possible.wlz
8789_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:8789_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
thymus primordium
moderate moderate
regionalmoderate expression: see section 11 12 13 14 15
submandibular gland primordium
moderate moderate
regionalmoderate expression: see section 07 08 09 10 17 18 19 20
pancreas
weak weak
regionalweak expression: see section 09 10 11
lateral ventricle choroid plexus
moderate moderate
regionalmoderate expression: see section 06 09 11 13 16 19
telencephalon ventricular layer
weak weak
regionalweak expression: see section 02 03 04 05 06 07 08 09 10 11 14 15 16 17 18 19 20 21 22 23
medulla oblongata basal plate mantle layer
moderate moderate
regionalmoderate expression: see section 08 09 15 16
pons mantle layer
moderate moderate
regionalmoderate expression: see section 07 17
metencephalon part of 4th ventricle choroid plexus
moderate moderate
regionalmoderate expression: see section 02 03 04 05 06 09 13 16 18 19
midbrain ventricular layer
weak weak
regionalweak expression: see section 07 08 09 10 11 12 13 14 15
facial vii ganglion
moderate moderate
regionalmoderate expression: see section 04 05 19 20 21
glossopharyngeal ix ganglion
moderate moderate
regionalmoderate expression: see section 18 weak expression: see section 06
trigeminal v ganglion
moderate moderate
regionalmoderate expression: see section 03 04 05 06 07 08 09 17 18 19 20 21 22
vagus x ganglion
moderate moderate
regionalmoderate expression: see section 07 08 17
ventral grey horn
strong strong
regionalstrong expression: see section 10 11 12 15 moderate expression: see section 13 14
cervico-thoracic ganglion
weak weak
regionalweak expression: see section 10 16
cervical ganglion
weak weak
regionalweak expression: see section 09 16
thoracic ganglion
weak weak
regionalweak expression: see section 12 13
dorsal root ganglion
strong strong
regionalstrong expression: see section 08 09 10 17 moderate expression: see section 06 07 12 13 14 15 16
neural retina
moderate moderate
regionalmoderate expression: see section 01 24 weak expression: see section 02 03 04 23
nasal cavity olfactory epithelium
moderate moderate
regionalmoderate expression: see section 14 weak expression: see section 09 10 11 12 13 15 16 17 18 19 20
vomeronasal organ
weak weak
regionalweak expression: see section 13 16
midgut
weak weak
regionalweak expression: see section 09 10 12 13 14 15 16 17 18 19
mandible
moderate moderate
regionalmoderate expression: see section 16 23 weak expression: see section 08 12 22
lower jaw incisor
moderate moderate
regionalmoderate expression: see section 12 13 16 17
lower jaw molar
weak weak
regionalweak expression: see section 08 19 20
upper jaw incisor
moderate moderate
regionalmoderate expression: see section 13 14 16 17
upper jaw molar
weak weak
regionalweak expression: see section 08 19 20
liver lobe
strong strong
single cellstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
renal cortex
moderate moderate
single cellmoderate expression: see section 06 07 08 09 10 16 17 18 19
testis
strong strong
regionalstrong expression: see section 05 06 07 08 18 19 20 21
lung
weak weak
regionalweak expression: see section 04 05 06 07 08 09 10 11 12 14 15 16 17 18 19 20 21 22 23 24
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T31743
Entity Detected:Hsp90aa1, heat shock protein 90, alpha (cytosolic), class A member 1 ( MGI:96250)
Sequence:sense strand is shown

>T31743
TGGCATGAAAACTAAGGGGAAGATAAAATTTCTACATGTGATACTGTGATACTATAGGTTTAACTCAAGA
GGTTGATAGAGCGTTTGTTATAAGACGTAACGTAACCTACTGTTCATGTTTGCTCTGGTCTGAAGTGTTT
AGCTGTTGAGCTGGATTCCTTAGGAGACCAAATTAAGATGGCTTAAATTACATCTTAAAATTTTCATTTC
CTGTAGTTAATTCTGCATGTATTAGTCTTAGAAGTAAACACAAGTTAAAACAACCTGACAGGAATTCCCC
AAGTGGCTTGTTTTCCAAAGTCCCGAGAACAACCCTAAGTTTCCTAGGTCTTGTAACTCAGCAAGGCTTG
TGAATGGAAATAACAGTGCCCAATCACATTCTG
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from the plasmid IMAGE:6491307), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 60646. Forward Primer - name:060646_F_IRAV91_g08_Hspca, sequence:TGGCATGAAAACTAAGGGGA; Reverse Primer - name:060646_R_SP6_IRAV91_g08_Hspca, sequence:GCAGAATGTGATTGGGCA. The reverse primer contains a 5' extension containing an SP6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using SP6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:8790 same embryo
 EMAGE:8791 same embryo
 EMAGE:8788 same embryo
 EMAGE:8792 same embryo
 EMAGE:8787 same embryo
 EurExpress:euxassay_010007 same experiment
 MGI:4825474 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS