Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:8877

Epb4.1l2 erythrocyte protein band 4.1-like 2 ( MGI:103009)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:8877 EMAGE:8877 EMAGE:8877 EMAGE:8877 EMAGE:8877
"Pseudo-wholemount" of euxassay_010082. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_010082_01 euxassay_010082_02 euxassay_010082_03 euxassay_010082_04
EMAGE:8877 EMAGE:8877 EMAGE:8877 EMAGE:8877 EMAGE:8877
euxassay_010082_05 euxassay_010082_06 euxassay_010082_07 euxassay_010082_08 euxassay_010082_09
EMAGE:8877 EMAGE:8877 EMAGE:8877 EMAGE:8877 EMAGE:8877
euxassay_010082_10 euxassay_010082_11 euxassay_010082_12 euxassay_010082_13 euxassay_010082_14
EMAGE:8877 EMAGE:8877 EMAGE:8877 EMAGE:8877 EMAGE:8877
euxassay_010082_15 euxassay_010082_16 euxassay_010082_17 euxassay_010082_18 euxassay_010082_19
EMAGE:8877 EMAGE:8877 EMAGE:8877 EMAGE:8877 EMAGE:8877
euxassay_010082_20 euxassay_010082_21 euxassay_010082_22 euxassay_010082_23 euxassay_010082_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:8877Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
8877_wholemount_strong.wlz
8877_wholemount_moderate.wlz
8877_wholemount_weak.wlz
8877_wholemount_possible.wlz
8877_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:8877_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
rib
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 19 20 21 23 24 moderate expression: see section 17 18 22
fibula
moderate moderate
regionalmoderate expression: see section 23 24
tibia
moderate moderate
regionalmoderate expression: see section 01 02 23 24
femur
moderate moderate
regionalmoderate expression: see section 21 22 weak expression: see section 03 04 05
diencephalon meninges
weak weak
regionalweak expression: see section 08 09 10 11 12 13 15 16 17 19
diencephalon roof plate
weak weak
regionalweak expression: see section 14
telencephalon meninges
weak weak
regionalweak expression: see section 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
hindbrain meninges
weak weak
regionalweak expression: see section 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22
midbrain meninges
weak weak
regionalweak expression: see section 07 08 09 10 11 12 13 14 16 17 18 20 21 22
spinal cord meninges
weak weak
regionalweak expression: see section 09 10 11 12 13 14
lens
moderate moderate
regionalmoderate expression: see section 24
nasal cavity olfactory epithelium
moderate moderate
regionalmoderate expression: see section 09 10 11 14 weak expression: see section 15 16
mandible
strong strong
regionalstrong expression: see section 02 03 04 05 06 07 08 13 14 15 16 17 18 19 20 21 22
maxilla
strong strong
regionalstrong expression: see section 04 05 06 07 08 13 14 15 16 17 18 19
bladder
moderate moderate
regionalExpression in the fundus region.
kidney calyx
strong strong
regionalstrong expression: see section 07 08 16 18 moderate expression: see section 09
kidney pelvis
strong strong
regionalstrong expression: see section 08 16 17
ureter
moderate moderate
regionalmoderate expression: see section 09 10 14 15
lung
weak weak
regionalweak expression: see section 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23
orbito-sphenoid
strong strong
regionalstrong expression: see section 01 02 03 04 05 20 21 22 23 24
clavicle
moderate moderate
regionalmoderate expression: see section 08 16 weak expression: see section 09 15
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T32123
Entity Detected:Epb4.1l2, erythrocyte protein band 4.1-like 2 ( MGI:103009)
Sequence:sense strand is shown

>T32123
GTGACCGAGGGCACCATAAGGGAAGAGCAGGAGGAGTGTGATGAAGAGCTGGAGGAAGAGCCCGGCCAAG
GAGCCAAGGTAGTAGAGAGGGAGGCAGCAGTGCCCGACGCCGTCCCAGACAGACAAGCAGGGGCCAGTGT
GCTCCCAGTAGAAACAGAGGCCCAGGAACATGTAGTTGCCCAAAAGTTACCTGGAGAAAAGGGTGCACAC
GGAGGCACTGCTGAGCAGGACCCGAGAGAAGAAGCAGAGGAAGACCCGCACAGAGTTAATGGAGAGGTGC
CCCATCTTGACCTTGATGGTTTGCCAGAGATTATTTGTTGTTCAGAGCCACCAGTGGTAAAAACAGAGAT
GGTAACAATTTCTGATGCCTCACAAAGGACAGAAATCTCCACCAAGGAAGTCCCCATTGTTCAAACTGAG
ACCAAAACCATCACATATGAGTCTCCACAGATTGACGGCGGGGCTGGTGGTGATTCGGGCGTGTTACTGA
CCGCACAAACCATCACATCTGAGTCCGCGTCAACAACGACAACCACACACATCACCAAGACTGTGAAAGG
TGGGATCTCTGAAACACGAATTGAGAAACGCATTGTGATCACAGGAGACGCAGCTCTGGATCATGATCAG
GCGCTGGCTCAGGCCATACGGGAAGCGAGAGAGCAGCACCCTGATATGTCGGTCACAAGGGTGGTAGTGC
ACAAAGAAACAGAGTTGGCGGAGGAAG
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from the plasmid IMAGE:6490305), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 59269. Forward Primer - name:059269_F_IRAV94_b07_Epb4.1l2, sequence:GTGACCGAGGGCACCATA; Reverse Primer - name:059269_R_SP6_IRAV94_b07_Epb4.1l2, sequence:CCTTCCTCCGCCAACTCT. The reverse primer contains a 5' extension containing an SP6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using SP6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:8878 same embryo
 EMAGE:8873 same embryo
 EMAGE:8875 same embryo
 EMAGE:8874 same embryo
 EMAGE:8876 same embryo
 EurExpress:euxassay_010082 same experiment
 MGI:4824571 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS