Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:9025

Chst2 carbohydrate sulfotransferase 2 ( MGI:1891160)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:9025 EMAGE:9025 EMAGE:9025 EMAGE:9025 EMAGE:9025
"Pseudo-wholemount" of euxassay_012897. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_012897_01 euxassay_012897_02 euxassay_012897_03 euxassay_012897_04
EMAGE:9025 EMAGE:9025 EMAGE:9025 EMAGE:9025 EMAGE:9025
euxassay_012897_05 euxassay_012897_06 euxassay_012897_07 euxassay_012897_08 euxassay_012897_09
EMAGE:9025 EMAGE:9025 EMAGE:9025 EMAGE:9025 EMAGE:9025
euxassay_012897_10 euxassay_012897_11 euxassay_012897_12 euxassay_012897_13 euxassay_012897_14
EMAGE:9025 EMAGE:9025 EMAGE:9025 EMAGE:9025 EMAGE:9025
euxassay_012897_15 euxassay_012897_16 euxassay_012897_17 euxassay_012897_18 euxassay_012897_19
EMAGE:9025 EMAGE:9025 EMAGE:9025 EMAGE:9025 EMAGE:9025
euxassay_012897_20 euxassay_012897_21 euxassay_012897_22 euxassay_012897_23 euxassay_012897_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:9025Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
9025_wholemount_strong.wlz
9025_wholemount_moderate.wlz
9025_wholemount_weak.wlz
9025_wholemount_possible.wlz
9025_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:9025_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
foot mesenchyme
weak weak
regionalweak expression: see section 01 02 03 22 23 24
head mesenchyme
weak weak
regionalweak expression: see section 01 02 03 04 05 20 21 22 23
submandibular gland primordium
weak weak
regionalweak expression: see section 07 08 16 17 18
pancreas
weak weak
regionalweak expression: see section 08 09 10 11 15 16 17
hypothalamus mantle layer
weak weak
regionalweak expression: see section 13
diencephalon lateral wall mantle layer
weak weak
regionalweak expression: see section 12
thalamus mantle layer
moderate moderate
regionalmoderate expression: see section 09 10 15 weak expression: see section 07 08 12 14 16 17
telencephalon mantle layer
moderate moderate
regionalmoderate expression: see section 05 06 19 20
medulla oblongata basal plate mantle layer
weak weak
spottedweak expression: see section 07 08 09 10 11 12 13 14 15 17
pons mantle layer
weak weak
spottedweak expression: see section 06 09 10 11 13 14 15 17 18
midbrain ventricular layer
weak weak
regionalweak expression: see section 10 11 13
ventral grey horn
weak weak
regionalweak expression: see section 10 11 12 13 14 15
lower lip
weak weak
regionalweak expression: see section 09 10 11 12 13 14 15 16
lower jaw incisor
weak weak
regionalweak expression: see section 10 11 14
lower jaw molar
strong strong
regionalstrong expression: see section 07 moderate expression: see section 06 18 19
upper lip
weak weak
regionalweak expression: see section 07 08 09 10 11 12 13 14 15 16 17 18
upper jaw incisor
weak weak
regionalweak expression: see section 10 11 14 15 17
upper jaw molar
strong strong
regionalstrong expression: see section 07 moderate expression: see section 06 19 weak expression: see section 18
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T38675
Entity Detected:Chst2, carbohydrate sulfotransferase 2 ( MGI:1891160)
Sequence:sense strand is shown

>T38675
TAGTACGTGATCCTCGTGCTGTTGCCAGCTCCCGCATCCGCTCGCGTCACGGCCTCATCCGGGAAAGCCT
ACAGGTGGTGCGAAGCCGGGATCCAAGAGCCCACCGCATGCCCTTCCTGGAGGCTGCTGGCCACAAGCTT
GGTGCCAAGAAGGAGGGTATGGGTGGCCCAGCAGACTACCACGCTCTGGGTGCAATGGAGGTCATCTGCA
ACAGTATGGCCAAGACGCTGCAAACAGCCCTGCAGCCTCCTGACTGGCTGCAGGGACACTACTTGGTGGT
GAGGTACGAGGATCTGGTGGGAGACCCCGTTAAGACCCTACGGAGGGTATATGACTTTGTGGGGCTGCTG
GTGAGTCCCGAAATGGAGCAGTTTGCCCTGAACATGACCAGT
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 155147. Forward Primer - name:155147_F_cDNA_TC1565734, sequence:TAGTACGTGATCCTCGTGCTGT; Reverse Primer - name:155147_N_SP6_cDNA_TC1565734, sequence:ACTGGTCATGTTCAGGGCAAA. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:9022 same embryo
 EMAGE:9026 same embryo
 EMAGE:9024 same embryo
 EMAGE:9023 same embryo
 EMAGE:9021 same embryo
 EurExpress:euxassay_012897 same experiment
 MGI:4823868 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS