Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:9897

Mllt3 myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 3 ( MGI:1917372)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:9897 EMAGE:9897 EMAGE:9897 EMAGE:9897 EMAGE:9897
"Pseudo-wholemount" of euxassay_008130. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_008130_01 euxassay_008130_02 euxassay_008130_03 euxassay_008130_04
EMAGE:9897 EMAGE:9897 EMAGE:9897 EMAGE:9897 EMAGE:9897
euxassay_008130_05 euxassay_008130_06 euxassay_008130_07 euxassay_008130_08 euxassay_008130_09
EMAGE:9897 EMAGE:9897 EMAGE:9897 EMAGE:9897 EMAGE:9897
euxassay_008130_10 euxassay_008130_11 euxassay_008130_12 euxassay_008130_13 euxassay_008130_14
EMAGE:9897 EMAGE:9897 EMAGE:9897 EMAGE:9897 EMAGE:9897
euxassay_008130_15 euxassay_008130_16 euxassay_008130_17 euxassay_008130_18 euxassay_008130_19
EMAGE:9897 EMAGE:9897 EMAGE:9897 EMAGE:9897 EMAGE:9897
euxassay_008130_20 euxassay_008130_21 euxassay_008130_22 euxassay_008130_23 euxassay_008130_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:9897Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
9897_wholemount_strong.wlz
9897_wholemount_moderate.wlz
9897_wholemount_weak.wlz
9897_wholemount_possible.wlz
9897_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:9897_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
rib
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 15 16 17 18 19 20 21 22
hindlimb digit 1 metatarsal
moderate moderate
regionalmoderate expression: see section 03 04 05 20 21 22 23
hindlimb digit 2 metatarsal
moderate moderate
regionalmoderate expression: see section 02 03 04 05 19 20 21 22 23
hindlimb digit 3 metatarsal
moderate moderate
regionalmoderate expression: see section 02 03 04 05 19 20 21 22 23
hindlimb digit 4 metatarsal
moderate moderate
regionalmoderate expression: see section 03 04 05 19 20 21 22
hindlimb digit 5 metatarsal
moderate moderate
regionalmoderate expression: see section 03 04 05 20 21 22
adrenal gland
moderate moderate
regionalmoderate expression: see section 09 10 17 18 19 weak expression: see section 08
submandibular gland primordium
moderate moderate
regionalmoderate expression: see section 06 07 08 09 19 20 weak expression: see section 17 18
brain
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
vibrissa
strong strong
regionalstrong expression: see section 05 06 07 08 moderate expression: see section 09 10 21 22 23 24
spinal cord
moderate moderate
regionalmoderate expression: see section 07 08 09 10 11 12 13 14 15 16 17
ear
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 19 20 21 23 weak expression: see section 22 24
inner ear
moderate moderate
regionalmoderate expression: see section 06 07 08 09 16 17 18
cornea epithelium
weak weak
regionalweak expression: see section 01 02 03 04 05 24
hindgut
moderate moderate
regionalmoderate expression: see section 13 weak expression: see section 15 16
rectum
moderate moderate
regionalmoderate expression: see section 14 weak expression: see section 13
lower jaw incisor
moderate moderate
regionalmoderate expression: see section 12 13 16 17 weak expression: see section 14
lower jaw molar
weak weak
regionalweak expression: see section 06 07 20
upper jaw incisor
moderate moderate
regionalmoderate expression: see section 12 13 17 weak expression: see section 14
upper jaw molar
weak weak
regionalweak expression: see section 06 07 20 21
liver lobe
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 13 14 15 17 18 19 20 21 22 23 24 weak expression: see section 12 16
genital tubercle of male
moderate moderate
regionalmoderate expression: see section 10 11 12 13 14 15 16
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T18
Entity Detected:Mllt3, myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 3 ( MGI:1917372)
Sequence:sense strand is shown

>T18
TCNTCTATTTATTACCACATACAGATAAAGTTGTGAGGGAATGACACCACCAGACGTCCTAAATACTCGG
TCCCGCGGATGCTCTTTCAATGCAGCGCCCTTGCCGTCCCAAGCCCAGTGACCTTATTCGTATACTGTGC
CACTTTCCACCAACTCTTCCCAGGTCCTTTAACTTGTTGCAGTCTATGGTTTCCATCTTTGTTTTCCCAG
TTCCAGGACATAGTTACCAACTGGGGGGACCAAATAGCCACCTTGATTTTCTTCCTTGTGGTCTTCTTTC
CTAAAGGTTGAGGCCCAGTCCTTGGCTGTATCCATGTAATGATCTTGGACATGGTAGATGTACCAAATAG
GATCATTTGAATTGCTGTCTAGCCTTAGTCAATAAACCTGTAGGACTTTGAACAAAAGTGTCCCTGTGAT
GTCCACAGCCCAGCAGTGCCGAGCTGTCACCAACACTCGTGTCTCTATTTTACTGTTGCAATATTAGGTG
AATATGGAGGTAAAGGCATTCCACAGACTCAGCATCTTAAAT
Notes:The probe template was PCR amplified from IMAGE:833180 using vector specific primers. Forward Primer - name:RZPD M13 forward, sequence:GCTATTACGCCAGCTGGCGAAAGGGGGATGTG; Reverse Primer - name:RZPD M13 reverse, sequence:CCCCAGGCTTTACACTTTATGCTTCCGGCTCG. Anti-sense probe was then transcribed from the PCR amplified template using T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:833180 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:NMRI
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:9898 same embryo
 EMAGE:9900 same embryo
 EMAGE:9899 same embryo
 EurExpress:euxassay_008130 same experiment
 MGI:4826393 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS