Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:10380

Col9a2 collagen, type IX, alpha 2 ( MGI:88466)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:10380 EMAGE:10380 EMAGE:10380 EMAGE:10380 EMAGE:10380
"Pseudo-wholemount" of euxassay_000512. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_000512_01 euxassay_000512_02 euxassay_000512_03 euxassay_000512_04
EMAGE:10380 EMAGE:10380 EMAGE:10380 EMAGE:10380 EMAGE:10380
euxassay_000512_05 euxassay_000512_06 euxassay_000512_07 euxassay_000512_08 euxassay_000512_09
EMAGE:10380 EMAGE:10380 EMAGE:10380 EMAGE:10380 EMAGE:10380
euxassay_000512_10 euxassay_000512_11 euxassay_000512_12 euxassay_000512_13 euxassay_000512_14
EMAGE:10380 EMAGE:10380 EMAGE:10380 EMAGE:10380 EMAGE:10380
euxassay_000512_15 euxassay_000512_16 euxassay_000512_17 euxassay_000512_18 euxassay_000512_19
EMAGE:10380 EMAGE:10380 EMAGE:10380 EMAGE:10380 EMAGE:10380
euxassay_000512_20 euxassay_000512_21 euxassay_000512_22 euxassay_000512_23 euxassay_000512_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:10380Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
10380_wholemount_strong.wlz
10380_wholemount_moderate.wlz
10380_wholemount_weak.wlz
10380_wholemount_possible.wlz
10380_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:10380_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
rib
strong strong
regionalstrong expression: see section 01 02 03 04 08 24
hand mesenchyme
moderate moderate
regionalmoderate expression: see section 01 02 03 04 24
hindlimb digit 1 mesenchyme
moderate moderate
regionalmoderate expression: see section 06
hindlimb digit 2 mesenchyme
moderate moderate
regionalmoderate expression: see section 06 24
hindlimb digit 3 mesenchyme
moderate moderate
regionalmoderate expression: see section 06 07 24
hindlimb digit 4 mesenchyme
moderate moderate
regionalmoderate expression: see section 07 23 24
hindlimb digit 5 mesenchyme
moderate moderate
regionalmoderate expression: see section 07 24
hip mesenchyme
moderate moderate
regionalmoderate expression: see section 01 02 03 04
otic capsule
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 08 09 15 16 17 18 19 20 21 22 23 24
viscerocranium
strong strong
regionalExpression in the turbinate bone.
axial skeleton cervical region
strong strong
regionalstrong expression: see section 08 15 16 moderate expression: see section 10 11 12 weak expression: see section 13
axial skeleton lumbar region
strong strong
regionalstrong expression: see section 13 15 16 moderate expression: see section 12 14
axial skeleton sacral region
strong strong
regionalstrong expression: see section 13 15 16 moderate expression: see section 14
axial skeleton thoracic region
strong strong
regionalstrong expression: see section 12 15 16 moderate expression: see section 10 11 14 weak expression: see section 13
cranium
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 19 20 21 22 23 24
pectoral girdle and thoracic body wall skeleton
strong strong
regionalstrong expression: see section 01 02 03 04 06 07 08 10 11 12 15 16 19 20 21 22 23 24 moderate expression: see section 14 18
axial skeleton tail region
strong strong
regionalstrong expression: see section 15 16
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T1730
Entity Detected:Col9a2, collagen, type IX, alpha 2 ( MGI:88466)
Sequence:sense strand is shown

>T1730
TGGCCTCGAGCCAGATTCGGCACGAGGAGGGGTTGGGGGAGGGAGAGCACGGGAGTAAAGGTGAGGCCAA
CAGAGCCAAGTATTGGAGAGCCACCCCTCCCAAGGGAAGAGGGTAGCTTCTCTTCCTGGAGTACCAACTA
CCCCTCACCCATGCCTTTCAGCACTGGGCCATCCCACCCTCGGGGCAGGGGGGACTGAGGCTTCTGGTGG
TCCTTACCCTATTCTTATTCTCTGGACTTATTTTTATTGGGTATCTTTTGGGGGAGAATACCTTGAGGTG
GCAGTTCTTAGGCCAGCCCTGCTATTGCCTGTCTCCCATCCCAGTATTTAAACATCCATCTTNCCCTGGT
CCCCCAGTCTCTTTTGGCCA
Notes:The probe template was PCR amplified from IMAGE:480602 using vector specific primers. Forward Primer - name:RZPD M13 forward, sequence:GCTATTACGCCAGCTGGCGAAAGGGGGATGTG; Reverse Primer - name:RZPD M13 reverse, sequence:CCCCAGGCTTTACACTTTATGCTTCCGGCTCG. Anti-sense probe was then transcribed from the PCR amplified template using T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:480602 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:10379 same embryo
 EMAGE:10382 same embryo
 EMAGE:10383 same embryo
 EMAGE:10381 same embryo
 EurExpress:euxassay_000512 same experiment
 MGI:4823996 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS