Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:12619

Kif13a kinesin family member 13A ( MGI:1098264)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:12619 EMAGE:12619 EMAGE:12619 EMAGE:12619 EMAGE:12619
"Pseudo-wholemount" of euxassay_011388. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_011388_01 euxassay_011388_02 euxassay_011388_03 euxassay_011388_04
EMAGE:12619 EMAGE:12619 EMAGE:12619 EMAGE:12619 EMAGE:12619
euxassay_011388_05 euxassay_011388_06 euxassay_011388_07 euxassay_011388_08 euxassay_011388_09
EMAGE:12619 EMAGE:12619 EMAGE:12619 EMAGE:12619 EMAGE:12619
euxassay_011388_10 euxassay_011388_11 euxassay_011388_12 euxassay_011388_13 euxassay_011388_14
EMAGE:12619 EMAGE:12619 EMAGE:12619 EMAGE:12619 EMAGE:12619
euxassay_011388_15 euxassay_011388_16 euxassay_011388_17 euxassay_011388_18 euxassay_011388_19
EMAGE:12619 EMAGE:12619 EMAGE:12619 EMAGE:12619
euxassay_011388_20 euxassay_011388_21 euxassay_011388_22 euxassay_011388_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:12619Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
12619_wholemount_strong.wlz
12619_wholemount_moderate.wlz
12619_wholemount_weak.wlz
12619_wholemount_possible.wlz
12619_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:12619_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
submandibular gland primordium
moderate moderate
regionalmoderate expression: see section 07 08 09 10 17 18 19 20
medulla oblongata basal plate mantle layer
strong strong
regionalstrong expression: see section 03 04 05 21 moderate expression: see section 20
rest of cerebellum mantle layer
strong strong
regionalstrong expression: see section 05 06 07 21 moderate expression: see section 20
facial vii ganglion
strong strong
regionalstrong expression: see section 05
dorsal root ganglion
moderate moderate
regionalmoderate expression: see section 08 09 10 11 12 17 18 19
pharyngo-tympanic tube
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 22 23
anterior naris
strong strong
regionalstrong expression: see section 12 13 moderate expression: see section 15 16
external naris
strong strong
regionalstrong expression: see section 11 12 17 18
naso-lacrimal duct
moderate moderate
regionalmoderate expression: see section 05 06 07
lower jaw incisor
strong strong
regionalstrong expression: see section 12 moderate expression: see section 10 11 16
lower jaw molar
moderate moderate
regionalmoderate expression: see section 06 20
oral epithelium
strong strong
regionalstrong expression: see section 05 06 07 08 09 17 18 19 20 21 moderate expression: see section 10 11 12 13 14 15 16
upper jaw molar
moderate moderate
regionalmoderate expression: see section 20
bladder
moderate moderate
regionalmoderate expression: see section 13 14
urethra of male
moderate moderate
regionalmoderate expression: see section 14 15
left lung
moderate moderate
regionalmoderate expression: see section 03 04 05 06 07 08 09 10 11 12 13
right lung
moderate moderate
regionalmoderate expression: see section 14 15 16 17 18 19 20 21 22 23
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T37767
Entity Detected:Kif13a, kinesin family member 13A ( MGI:1098264)
Sequence:sense strand is shown

>T37767
CAGGAAGCTGATGCTTACACAGCCTTATGTGCCCGTGGAGTTCGCTGACTTCAGTGTTTACAATGCCAGC
TTGGAGAACAGGGAGTGGTCCTCTTCTAAGGCGGACCTGACAGACTCGAGAGCCTTGGAGAAAGCAGTGT
CCCGTAGCCCTACCACCAGCAGCCTCACCAGTGGCTACTTCTCCCACAGTGCCTCCAATGCCACTCTGTC
TGACATGGCAGTCCCCTCCAGCGACAGCTCAGACCAGCTTGCCGTCTCGACAAAGGAGGTCGAGTGCGCC
GAGCCCCCGGGACCATCACTTGCACCGGATGTCAGACGAGCTTCGAATCAGGAGCTTACAGAAGTAGGAA
GAGGCTCAGGGAAGGATGAGACAATCGCTGTGCCGCTGGAGGAAAACAGTGCCTTACCCAAGGGGACCCC
GTCACCCCAGAGCATCCCTGAGGAAAGTTCCAGAATGCCATGCAGGACTGCTTCATGTTCAGAACTGGAT
GTCGGCCCCAGCAAAGATGGCCACCAAGCCAGAGAATTCTGCCCAGGAGAGGTGACGATAGAACACACTA
CAAACATTTTGGAGGACCATTCCTTCACAGAGTTCATGGGTGTTTCTGATGGCAAAGACTTTGATGGTTT
GGCAGATTGTTCTGTAGGGGAGCCCTCCAGGAGGAGGGCTCTAACAAACGAAACAGACCATAAAGGTATC
CCAGAAAGACCTCCAGATGCCGACCGGCTGCATCCCAAGATAGAGAACGACCAGGAAGCCACAGCCACTC
GGTAAGGGACAGCCATGCCTCTCCAGGTCACAGCTTGGCAGCTTCGTTCATCAATCCCACCCTGGGACAG
TCCATGCTCCATCTTCAGACAGCTGTGACCCAGCTCGACCTCAGACCAGCATAGGGGAGCCCTGCACTTC
CCCTCCCCAGTGGGAGAAGCAGCACTTTGTTCCATGGTGAATCACAGCTCCCTGCTCTTTC
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 90131. Forward Primer - name:090131_F_cDNA_Kif13a, sequence:CAGGAAGCTGATGCTTACACAG; Reverse Primer - name:090131_N_SP6_cDNA_Kif13a, sequence:GAAAGAGCAGGGAGCTGTGAT. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:12624 same embryo
 EMAGE:12623 same embryo
 EMAGE:12621 same embryo
 EMAGE:12620 same embryo
 EMAGE:12622 same embryo
 EurExpress:euxassay_011388 same experiment
 MGI:4825751 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS