Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:12661

Rgs4 regulator of G-protein signaling 4 ( MGI:108409)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:12661 EMAGE:12661 EMAGE:12661 EMAGE:12661 EMAGE:12661
"Pseudo-wholemount" of euxassay_011462. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_011462_01 euxassay_011462_02 euxassay_011462_03 euxassay_011462_04
EMAGE:12661 EMAGE:12661 EMAGE:12661 EMAGE:12661 EMAGE:12661
euxassay_011462_05 euxassay_011462_06 euxassay_011462_07 euxassay_011462_08 euxassay_011462_09
EMAGE:12661 EMAGE:12661 EMAGE:12661 EMAGE:12661 EMAGE:12661
euxassay_011462_10 euxassay_011462_11 euxassay_011462_12 euxassay_011462_13 euxassay_011462_14
EMAGE:12661 EMAGE:12661 EMAGE:12661 EMAGE:12661 EMAGE:12661
euxassay_011462_15 euxassay_011462_16 euxassay_011462_17 euxassay_011462_18 euxassay_011462_19
EMAGE:12661 EMAGE:12661 EMAGE:12661 EMAGE:12661 EMAGE:12661
euxassay_011462_20 euxassay_011462_21 euxassay_011462_22 euxassay_011462_23 euxassay_011462_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:12661Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
12661_wholemount_strong.wlz
12661_wholemount_moderate.wlz
12661_wholemount_weak.wlz
12661_wholemount_possible.wlz
12661_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:12661_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
adrenal gland
weak weak
regionalweak expression: see section 10 11 12 19 20 21
thymus primordium
moderate moderate
regionalmoderate expression: see section 14 15 16 17 weak expression: see section 13
hypothalamus mantle layer
moderate moderate
regionalmoderate expression: see section 09 10 11 12 13 15 16 17 18
diencephalon lateral wall mantle layer
moderate moderate
regionalmoderate expression: see section 09 10 11 12 13 14 15 16 17
cerebral cortex marginal layer
moderate moderate
regionalmoderate expression: see section 11 12 13 14 15 16 22 23 24 weak expression: see section 03 04 05 06 07 08 09 10 18 19 20 21
telencephalon mantle layer
moderate moderate
regionalmoderate expression: see section 05 06 07 08 09 11 12 13 15 16 17 18 19 20 21 22 23 24 weak expression: see section 03 04
medulla oblongata basal plate mantle layer
moderate moderate
regionalmoderate expression: see section 08 09 10 11 12 13 14 15 16 17 18 19 20
rest of cerebellum mantle layer
moderate moderate
regionalmoderate expression: see section 07 08 09 10 11 12 13 15 16 17 18 19 20 21 weak expression: see section 04 05 22 23
pons mantle layer
moderate moderate
regionalmoderate expression: see section 06 07 08 09 10 11 13 14 15 16 17 18 19 20 21 weak expression: see section 12
midbrain mantle layer
moderate moderate
regionalmoderate expression: see section 07 08 09 10 11 13 14 15 16 17 18 19 20 21 weak expression: see section 12
facial vii ganglion
strong strong
single cellstrong expression: see section 05 06 07 22 23
glossopharyngeal ix ganglion
strong strong
single cellstrong expression: see section 08 09 21 moderate expression: see section 20
trigeminal v ganglion
strong strong
single cellstrong expression: see section 04 05 06 07 08 09 10 19 20 21 22 23 24
vagus x ganglion
strong strong
single cellstrong expression: see section 10
vestibulocochlear viii ganglion
strong strong
single cellstrong expression: see section 08 moderate expression: see section 20 weak expression: see section 19
trigeminal v nerve
strong strong
single cellstrong expression: see section 10 11
spinal cord mantle layer
moderate moderate
regionalmoderate expression: see section 11 12 13 14 15 16 17 18 19
cervico-thoracic ganglion
strong strong
regionalstrong expression: see section 12 13 18 19
cervical ganglion
strong strong
regionalstrong expression: see section 11 19
thoracic ganglion
strong strong
regionalstrong expression: see section 15 16 17
dorsal root ganglion
strong strong
regionalstrong expression: see section 09 10 11 12 13 14 18 19 20
neural retina
weak weak
regionalweak expression: see section 01 02 03 04 24
aorta
moderate moderate
regionalmoderate expression: see section 14 15 16 17
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T30178
Entity Detected:Rgs4, regulator of G-protein signaling 4 ( MGI:108409)
Sequence:sense strand is shown

>T30178
ATGGCCTTCCCTCCTTTGCCTGGGTGCTCAGGGTGTGCTGATTAGCAGCTGGGTTGGTCTAGAGCTGAAT
GTTTGAGCTGAATGAAGGAATGTGGTCCAGGCTTTGCTGCCTAGCCCTACCAAGGACTACTGCTTAGGTG
AGGGCAGAGGACCTAAAGATTATCTTAATTCTTTCCTCTTTTGATAAGGTGCTCTTCTTTTCCTTCCCCT
CAAGAATGTCACCTGTCAGAGGAGCCTCCTTAGTTCCCTGTGGTTGGTTGTTCACTTTAAAAACCACGGC
TACCTGCCGTGGTTCTAAGCTACATGCCTACATCTGTAAAGCATCATCGGGGGGAAAGGTTATGTTTTAT
CAGGAGGAAGGAAGTTCTCATGAACTGCAAAGCCCTCTTTGGTTTTCTGCTTTGAGGTAAGAGCTTGTTC
ACCCCATCCCAAACACCAAGGCTAGCAGAGACCAATGAAAGGAGAGAGGAAAGGAAAAAGAAAGAGAAAA
GAAAACAGAAGAGGAGAGGCTATCAGTTGGTAGGACTACTGCTTGGAGCTTTTCAAGGCACGTGAAATAC
TTGAAAATTTCTCATTTGTGTTATTTATGATGTTTTGTACAGTGTTTTTATTATTGTATTGTTTTATAAA
TGGAGGTACAGGATATTACCCAAATTATTAATGAATGCCCAAGAAGTAATTTCCTTCTCATTCTTCTAAA
AGTACTGCCTTTGAGAGCACACACACATTCGTGCAACACTGCAGTCATTGCTCCAGTTTAAATTACATGT
GTGAGCACCATTGCGGCTAGTAAGCCAATGTACCAGGCTGCAAAATGAAGACACTGGAATAGTGTGTATC
CAAGTCTCGTCGTATTGAAGAAATAATTTTCTAAGGGTACTCGTTTCGTCTCTCTTGACAGTCTTGCTTG
TAATGTCCCCAGAGCTCC
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from the plasmid IMAGE:3496887), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 8874. Forward Primer - name:ABA_MGC_004_02_F05_F_CGCAAAGTGCAACAGGTG_ABA_REV_00, sequence:ATGGCCTTCCCTCCTTTG; Reverse Primer - name:_R_SP6_ABA_MGC_008_02_B12_ATGGCCTTCCCTCCTTTGCCTGGG, sequence:GGGAGCTCTGGGGACATT. The reverse primer contains a 5' extension containing an SP6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using SP6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:12662 same embryo
 EMAGE:12660 same embryo
 EMAGE:12659 same embryo
 EMAGE:12657 same embryo
 EMAGE:12658 same embryo
 EurExpress:euxassay_011462 same experiment
 MGI:4827721 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS