Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:12984

Rnpc3 RNA-binding region (RNP1, RRM) containing 3 ( MGI:1914475)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:12984 EMAGE:12984 EMAGE:12984 EMAGE:12984 EMAGE:12984
"Pseudo-wholemount" of euxassay_013667. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_013667_01 euxassay_013667_02 euxassay_013667_03 euxassay_013667_04
EMAGE:12984 EMAGE:12984 EMAGE:12984 EMAGE:12984 EMAGE:12984
euxassay_013667_05 euxassay_013667_06 euxassay_013667_07 euxassay_013667_08 euxassay_013667_09
EMAGE:12984 EMAGE:12984 EMAGE:12984 EMAGE:12984 EMAGE:12984
euxassay_013667_10 euxassay_013667_11 euxassay_013667_12 euxassay_013667_13 euxassay_013667_14
EMAGE:12984 EMAGE:12984 EMAGE:12984 EMAGE:12984 EMAGE:12984
euxassay_013667_15 euxassay_013667_16 euxassay_013667_17 euxassay_013667_18 euxassay_013667_19
EMAGE:12984 EMAGE:12984 EMAGE:12984 EMAGE:12984
euxassay_013667_20 euxassay_013667_21 euxassay_013667_22 euxassay_013667_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:12984Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
12984_wholemount_strong.wlz
12984_wholemount_moderate.wlz
12984_wholemount_weak.wlz
12984_wholemount_possible.wlz
12984_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:12984_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
diencephalon lateral wall mantle layer
weak weak
regionalweak expression: see section 08 09 10 11 12 13 14 15 16 17 18 19
telencephalon mantle layer
weak weak
regionalweak expression: see section 01 02 03 04 05 06 08 09 10 11 12 15 16 17 18 19 20 21 22 23
medulla oblongata basal plate mantle layer
weak weak
regionalweak expression: see section 08 09 10 11 12 13 14 15 16 17 18 19
rest of cerebellum mantle layer
weak weak
regionalweak expression: see section 05 06 07 08 09 10 15 16 17 18
pons mantle layer
weak weak
regionalweak expression: see section 06 07 08 09 10 11 12 13 14 15 16 18 19 20 21
pons marginal layer
weak weak
regionalweak expression: see section 17
midbrain mantle layer
weak weak
regionalweak expression: see section 06 07 08 09 10 11 12 13 14 15 16 17 18 19
facial vii ganglion
moderate moderate
regionalmoderate expression: see section 05 06 21 22
glossopharyngeal ix ganglion
moderate moderate
regionalmoderate expression: see section 09 20 21
trigeminal v ganglion
moderate moderate
regionalmoderate expression: see section 04 05 06 07 08 09 10 18 19 20 21 22 23
vagus x ganglion
moderate moderate
regionalmoderate expression: see section 10
vestibulocochlear viii ganglion
moderate moderate
regionalmoderate expression: see section 07 08 09 19 20 21
trigeminal v nerve
moderate moderate
regionalmoderate expression: see section 10 18
ventral grey horn
weak weak
regionalweak expression: see section 11 12 13 14 15 16 17 18
dorsal root ganglion
moderate moderate
regionalmoderate expression: see section 09 10 11 15 16 17 18 19 weak expression: see section 20
nasal cavity olfactory epithelium
weak weak
regionalweak expression: see section 10 11 13 15 16 17 18
vomeronasal organ
weak weak
regionalweak expression: see section 13
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T30998
Entity Detected:Rnpc3, RNA-binding region (RNP1, RRM) containing 3 ( MGI:1914475)
Sequence:sense strand is shown

>T30998
TCAAGCACAATCCTCGCAAATATAGTAAATGCTCTGGCAAGTGTCCCAAAATTCTATGTACAGGTGCTTC
ATCTTATGAATAAAATGAATTTGCCCACACCATTTGGACCGATTACTGCACGACCTCCTATGTATGAGGA
CTATATGCCATTGCATGCACCCCTTCCACCTACATCCCCTCAACCGCCTGAGGAGCCTCCCTTACCAGAT
GAGGATGAGGATTTATCTAGCAAAGAATCAGAATATGAAAGCAGTGATGAGGAGGACCGACAGAGAATGA
ACAGATTAATGGAACTAGCAAATCTTCAGCCCAAAAGACCCAAAACAGAAAAGCCACGCCACGTGAGAAA
AAAGCGAAAAATAAAGGATATGTTGAATATACCTTCATCAGCTTCACATAGTTTGCATCCTGTGCTGTTA
CCTTCGGATGTATTTGACCAGCCACAATCTGTAGGTAATAAAAAAATTGAGTTCAATATATCAACCAACA
TGCCTGCAGCATTTAACAAAGATTTGGAGACACAACCAAATAATGAAGAAGAAAATTCTGATTCACCAGA
CACTGGACTTGATTCAAATACAGGATTTGGCAAAATCTTCCCTAAACCTAATTTGAACATCACAGAAGAG
ATTACAGAAGACTCTGATGAAATACCTTCACAATTTATTTCTAGAAAAGAGTTGGAAAAGGGTCGTATTT
CTAGAGAAGAAATGGAAACACTTTCAGTTTTTAGAAGTTATGAACCTGGTGAACCAAACTGCAGAATTTA
TGTAAAGAATTTAGCTAGACATGTTCAGGAAAAGGACCTTAAATTTATATTTGGAAGATACGTTGACTTT
TCTTCAGAAACACAGCGGATCATGTTTGATATTCGCTTAATGAAAGAAGGACGCATGAAAGGACAAGCTT
TTGTTGGACTTCCAAATGAAAAAGCAGCCGCTAAAGCGTTGAA
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from the plasmid IMAGE:3587176), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 21510. Forward Primer - name:021510_F_IRAV32-35_G07_2810441O16Rik, sequence:TCAAGCACAATCCTCGCA; Reverse Primer - name:021510_R_SP6_IRAV32-35_G07_2810441O16Rik, sequence:TTTCAACGCTTTAGCGGC. The reverse primer contains a 5' extension containing an SP6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using SP6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:12985 same embryo
 EMAGE:12986 same embryo
 EMAGE:12988 same embryo
 EMAGE:12989 same embryo
 EMAGE:12987 same embryo
 EurExpress:euxassay_013667 same experiment
 MGI:4827784 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS