Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:17794

Zdhhc24 zinc finger, DHHC domain containing 24 ( MGI:1917855)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:17794 EMAGE:17794 EMAGE:17794 EMAGE:17794 EMAGE:17794
"Pseudo-wholemount" of euxassay_008963. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_008963_01 euxassay_008963_02 euxassay_008963_03 euxassay_008963_04
EMAGE:17794 EMAGE:17794 EMAGE:17794 EMAGE:17794 EMAGE:17794
euxassay_008963_05 euxassay_008963_06 euxassay_008963_07 euxassay_008963_08 euxassay_008963_09
EMAGE:17794 EMAGE:17794 EMAGE:17794 EMAGE:17794 EMAGE:17794
euxassay_008963_10 euxassay_008963_11 euxassay_008963_12 euxassay_008963_13 euxassay_008963_14
EMAGE:17794 EMAGE:17794 EMAGE:17794 EMAGE:17794 EMAGE:17794
euxassay_008963_15 euxassay_008963_16 euxassay_008963_17 euxassay_008963_18 euxassay_008963_19
EMAGE:17794 EMAGE:17794 EMAGE:17794 EMAGE:17794
euxassay_008963_20 euxassay_008963_21 euxassay_008963_22 euxassay_008963_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:17794Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
17794_wholemount_strong.wlz
17794_wholemount_moderate.wlz
17794_wholemount_weak.wlz
17794_wholemount_possible.wlz
17794_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:17794_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
adrenal medulla
strong strong
regionalstrong expression: see section 08 09 10 11 16 17 18
diencephalon lateral wall mantle layer
moderate moderate
regionalmoderate expression: see section 06 07 08 09 10 11 12 13 14 15 16 17
telencephalon mantle layer
moderate moderate
regionalmoderate expression: see section 01 02 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23
telencephalon marginal layer
moderate moderate
regionalmoderate expression: see section 03
medulla oblongata alar plate mantle layer
moderate moderate
regionalmoderate expression: see section 04 05 06 07 08 09 10 11 12 13 14 15 16
medulla oblongata basal plate mantle layer
moderate moderate
regionalmoderate expression: see section 04 05 06 07 08 09 10 11 12 13 14 15 16
rest of cerebellum mantle layer
moderate moderate
regionalmoderate expression: see section 03 04 05 06 07 08 09 10 11 12 13 14 15
pons mantle layer
moderate moderate
regionalmoderate expression: see section 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17
midbrain mantle layer
moderate moderate
regionalmoderate expression: see section 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17
spinal cord mantle layer
moderate moderate
regionalmoderate expression: see section 06 07 08 09 10 11 12 13 14
seminiferous cord
strong strong
regionalstrong expression: see section 07 08 09 10 20 21 22
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T35481
Entity Detected:Zdhhc24, zinc finger, DHHC domain containing 24 ( MGI:1917855)
Sequence:sense strand is shown

>T35481
TCATGCTACTCACAGGCAAAGTGTCTCTGGCCCAGTTTGCCCTGGCCTTTGTGGTGGACACGTGTGTGGC
AGGTGCACTGTTGTGTGGTGCTGGGCTGCTTTTCCATGGGATGCTGCTGCTTCGGGGACAGACCACCTGG
GAGTGGGCTCGGGGTCACCACTGCTATGACCTGGGCACCTGCCACAACCTGCAGGCAGCCCTGGGGCCTC
GCTGGGCCCTAGTCTGGTTCTGGCCTTTTCTAGCCTCTCCTTTGCCTGGAGATGGGATCTCTTTCCAGAC
TCCAGGTGATGTGGGTCTTGTGACTTCCTGAGTCCAGGTAGAGCCAGAACTGAACAGGGCAGAGGATCGA
ACTGAGAACTTTTTAGCTTCATGCCAGCCGCAGGAGGAAGGCCCGATTGCCCCTTCATGTGTGTAGTGGG
CAGCTTTAGCTCCTTCTTTGAACCTGCCCAATGTGGGCTCTTCTATCTCTGTAGTTGGCCCTTTTGGCAG
AGGATGGTCTAGCAAGGGGGCTACTTGGCCTGACCGACTGCCCCTCTGCAGGGTAGTAAAGTGCCAACCT
GGTTCTTGGCCTCCTCCATCTTTGCTGGGTTCCTATACCTCACTTTGTTGTTTTGGTTGCTGTTTCCCAG
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 65370. Forward Primer - name:065370_F_cDNA_Leng4, sequence:TCATGCTACTCACAGGCAAAGT; Reverse Primer - name:065370_N_SP6_cDNA_Leng4, sequence:CTGGGAAACAGCAACCAAAAC. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:17796 same embryo
 EMAGE:17795 same embryo
 EMAGE:17793 same embryo
 EMAGE:17792 same embryo
 EMAGE:17797 same embryo
 EurExpress:euxassay_008963 same experiment
 MGI:4829282 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS