Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:19877

Ppp1r18 protein phosphatase 1, regulatory subunit 18 ( MGI:1923698)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:19877 EMAGE:19877 EMAGE:19877 EMAGE:19877 EMAGE:19877
"Pseudo-wholemount" of euxassay_006379. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_006379_01 euxassay_006379_02 euxassay_006379_03 euxassay_006379_04
EMAGE:19877 EMAGE:19877 EMAGE:19877 EMAGE:19877 EMAGE:19877
euxassay_006379_05 euxassay_006379_06 euxassay_006379_07 euxassay_006379_08 euxassay_006379_09
EMAGE:19877 EMAGE:19877 EMAGE:19877 EMAGE:19877 EMAGE:19877
euxassay_006379_10 euxassay_006379_11 euxassay_006379_12 euxassay_006379_13 euxassay_006379_14
EMAGE:19877 EMAGE:19877 EMAGE:19877 EMAGE:19877 EMAGE:19877
euxassay_006379_15 euxassay_006379_16 euxassay_006379_17 euxassay_006379_18 euxassay_006379_19
EMAGE:19877 EMAGE:19877 EMAGE:19877 EMAGE:19877
euxassay_006379_20 euxassay_006379_21 euxassay_006379_22 euxassay_006379_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:19877Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
19877_wholemount_strong.wlz
19877_wholemount_moderate.wlz
19877_wholemount_weak.wlz
19877_wholemount_possible.wlz
19877_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:19877_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
brain
strong strong
regionalstrong expression: see section 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23
facial vii ganglion
strong strong
homogeneousstrong expression: see section 04 05 06 07 19 20
glossopharyngeal ix ganglion
strong strong
homogeneousstrong expression: see section 06 07 17
trigeminal v ganglion
strong strong
homogeneousstrong expression: see section 03 04 05 06 07 08 17 18 19 20 21 22
vagus x ganglion
strong strong
homogeneousstrong expression: see section 07 16 17
vestibulocochlear viii ganglion
strong strong
homogeneousstrong expression: see section 06 07 17 18
trigeminal v nerve
strong strong
homogeneousstrong expression: see section 09 17
spinal cord
strong strong
regionalstrong expression: see section 06 07 08 09 10 11 12 13 14 15 16 17
cervico-thoracic ganglion
moderate moderate
regionalmoderate expression: see section 07 08 13
cervical ganglion
moderate moderate
regionalmoderate expression: see section 07 08 15 16
thoracic ganglion
moderate moderate
regionalmoderate expression: see section 08 12
dorsal root ganglion
strong strong
regionalstrong expression: see section 06 07 08 09 10 11 12 13 14 15 16 17
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T35030
Entity Detected:Ppp1r18, protein phosphatase 1, regulatory subunit 18 ( MGI:1923698)
Sequence:sense strand is shown

>T35030
GAGCTCGGTACTGGAGGATCTAGGCCCGGAGCCTGAGACCCCCATTGCCCCCTTAGCAACCCAGCCTGAC
GAGGAGGAGGAGGAGGAGGAGGAAGAGGAGGAGTTGCTTCTGCAGCCTGGGCTCCAGGGCGGGCTGCGCA
CCAAGGCCCTAATCGTGGGTAAGCGGCTGCGGCCTGGTTGGCGGAGGGCGCCCCCTGGTGTCTGTGGTGT
GGTGGTACTTTGAAGGAGCTTGGCCTAAACTCCCTGATTCCTGAAAGCCAAGTACACATGGGATCTCCAG
ATTTGAAAACCAGAGCTCCCTCGTTCTCCAGCTCTCTAATCTGGTTAAAAACACCCGTGTTGGGTCAGAC
GGCGTGGAGTTGGAATTCCAGCTTGTCTGTTACTCAGGCGTGATCCTGAATCAATCCGAGCTCAGGCTTC
CACTTATCTTTATGTGGGGGGTGCATGCCTGCACTCAAGGGTCAGATCCAAGGCCTTGAGCATACTAGGC
GAGTGCTCTGCTGTTGATTGGTAGCCCCAGCCTTCATTTATCGTTCT
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 85401. Forward Primer - name:085401_F_cDNA_2310014H01Rik, sequence:GAGCTCGGTACTGGAGGATCTA; Reverse Primer - name:085401_N_SP6_cDNA_2310014H01Rik, sequence:AGAACGATAAATGAAGGCTGG. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:19874 same embryo
 EMAGE:19876 same embryo
 EMAGE:19873 same embryo
 EMAGE:19875 same embryo
 EurExpress:euxassay_006379 same experiment
 MGI:4822660 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS