Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:6094

Atp8a1 ATPase, aminophospholipid transporter (APLT), class I, type 8A, member 1 ( MGI:1330848)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:6094 EMAGE:6094 EMAGE:6094 EMAGE:6094 EMAGE:6094
"Pseudo-wholemount" of euxassay_007730. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_007730_01 euxassay_007730_02 euxassay_007730_03 euxassay_007730_04
EMAGE:6094 EMAGE:6094 EMAGE:6094 EMAGE:6094 EMAGE:6094
euxassay_007730_05 euxassay_007730_06 euxassay_007730_07 euxassay_007730_08 euxassay_007730_09
EMAGE:6094 EMAGE:6094 EMAGE:6094 EMAGE:6094 EMAGE:6094
euxassay_007730_10 euxassay_007730_11 euxassay_007730_12 euxassay_007730_13 euxassay_007730_14
EMAGE:6094 EMAGE:6094 EMAGE:6094 EMAGE:6094 EMAGE:6094
euxassay_007730_15 euxassay_007730_16 euxassay_007730_17 euxassay_007730_18 euxassay_007730_19
EMAGE:6094 EMAGE:6094 EMAGE:6094 EMAGE:6094 EMAGE:6094
euxassay_007730_20 euxassay_007730_21 euxassay_007730_22 euxassay_007730_23 euxassay_007730_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:6094Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
6094_wholemount_strong.wlz
6094_wholemount_moderate.wlz
6094_wholemount_weak.wlz
6094_wholemount_possible.wlz
6094_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:6094_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: three stars
Text Annotation:
StructureLevelPatternNotes
thymus primordium
strong strong
regionalstrong expression: see section 11 12 13 14 15 16
brain
strong strong
regionalstrong expression: see section 11 12 13 14 15 16 moderate expression: see section 05 06 07 08 09 10 17 18 19 20 21 22 23 24 weak expression: see section 01 02 03 04
facial vii ganglion
strong strong
regionalstrong expression: see section 04 05 06 20 21 22
glossopharyngeal ix ganglion
strong strong
regionalstrong expression: see section 07 19
trigeminal v ganglion
strong strong
regionalstrong expression: see section 03 04 05 06 07 08 09 17 18 19 20 21 22 23
vagus x ganglion
strong strong
regionalstrong expression: see section 08 18
vestibulocochlear viii ganglion
strong strong
regionalstrong expression: see section 05 06 07 08 09 19 20 21 moderate expression: see section 18
trigeminal v nerve
strong strong
regionalstrong expression: see section 10 17
spinal cord
strong strong
regionalstrong expression: see section 10 11 12 13 14 15 16
cervico-thoracic ganglion
moderate moderate
regionalmoderate expression: see section 10
cervical ganglion
moderate moderate
regionalmoderate expression: see section 09
thoracic ganglion
moderate moderate
regionalmoderate expression: see section 12 13 16
dorsal root ganglion
strong strong
regionalstrong expression: see section 07 09 10 11 12 13 17 18 19 moderate expression: see section 08 16
neural retina
moderate moderate
regionalmoderate expression: see section 24 weak expression: see section 01 02 03 04
anterior naris
moderate moderate
regionalmoderate expression: see section 11
nasal cavity olfactory epithelium
moderate moderate
regionalmoderate expression: see section 11 12 13 15 16 weak expression: see section 10
rectum
moderate moderate
regionalmoderate expression: see section 13 14
liver
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
left lung
strong strong
regionalstrong expression: see section 03 04 05 06 07 08 09 10 11 12 13 14
right lung
strong strong
regionalstrong expression: see section 15 16 17 18 19 20 21 22 23 24
Annotation Validation: EMAGE Editor
Detection Reagent
Type:in situ hybridisation probe
Identifier:T35964
Entity Detected:Atp8a1, ATPase, aminophospholipid transporter (APLT), class I, type 8A, member 1 ( MGI:1330848)
Sequence:sense strand is shown

>T35964
CAGAGCTCACAGTTTGGAGATGAAAAAACCTTTAATGACCCGTCGTTGCTGGACAATCTCCAGAATAACC
ACCCAACCGCACCTATCATCTGTGAATTTCTCACAATGATGGCCGTCTGCCACACAGCTGTACCGGAGAG
AGAAGGGGACAAGATCATTTATCAGGCTGCATCGCCAGATGAGGGTGCACTGGTCAGAGCCGCCAAGCAG
TTGAATTTTGTCTTCACTGGAAGAACTCCTGACTCTGTCATCATAGATTCACTGGGGCAGGAAGAAAGAT
ATGAATTGCTCAATGTCCTAGAGTTCACCAGTGCTAGGAAGAGGATGTCGGTGGTGGTTCGCACTCCATC
CGGGAAGTTACGGCTCTACTGCAAAGGAGCTGACACAGTAATTTATGAACGACTTGCAGAGACCTCAAAG
TACAAAGAAATCACCCTAAAACACTTGGAACAGTTTGCTACAGAAGGGCTGAGGACTTTGTGTTTTGCTG
TGGCTGAGATTTCTGAGAGCGACTTCGAGGAGTGGCGGGCCGTCTACCACCGCGCATCCACGTCGGTACA
GAACAGGCTGCTGAAGCTGGAGGAGAGCTACGAACTAATTGAAAAGAATCTTCAGCTACTTGGAGCTACA
G
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 98934. Forward Primer - name:098934_F_cDNA_Atp8a1, sequence:CAGAGCTCACAGTTTGGAGATG; Reverse Primer - name:098934_N_SP6_cDNA_Atp8a1, sequence:CTGTAGCTCCAAGTAGCTGAAGA. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:7851 same embryo
 EMAGE:7849 same embryo
 EMAGE:7848 same embryo
 EMAGE:7850 same embryo
 EMAGE:6095 same embryo
 EurExpress:euxassay_007730 same experiment
 MGI:4823343 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS