Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:10588

Dnmt3b DNA methyltransferase 3B ( MGI:1261819)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:10588 EMAGE:10588 EMAGE:10588 EMAGE:10588 EMAGE:10588
"Pseudo-wholemount" of euxassay_000914. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_000914_01 euxassay_000914_02 euxassay_000914_03 euxassay_000914_04
EMAGE:10588 EMAGE:10588 EMAGE:10588 EMAGE:10588 EMAGE:10588
euxassay_000914_05 euxassay_000914_06 euxassay_000914_07 euxassay_000914_08 euxassay_000914_09
EMAGE:10588 EMAGE:10588 EMAGE:10588 EMAGE:10588 EMAGE:10588
euxassay_000914_10 euxassay_000914_11 euxassay_000914_12 euxassay_000914_13 euxassay_000914_14
EMAGE:10588 EMAGE:10588 EMAGE:10588 EMAGE:10588 EMAGE:10588
euxassay_000914_15 euxassay_000914_16 euxassay_000914_17 euxassay_000914_18 euxassay_000914_19
EMAGE:10588 EMAGE:10588 EMAGE:10588 EMAGE:10588 EMAGE:10588
euxassay_000914_20 euxassay_000914_21 euxassay_000914_22 euxassay_000914_23 euxassay_000914_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:10588Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
10588_wholemount_strong.wlz
10588_wholemount_moderate.wlz
10588_wholemount_weak.wlz
10588_wholemount_possible.wlz
10588_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:10588_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
thymus primordium
moderate moderate
homogeneousmoderate expression: see section 13 14 15 16 17
telencephalon
moderate moderate
homogeneousmoderate expression: see section 01 02 03 04 05 06 08 12 17 18 21 weak expression: see section 07 09 10 11 14 15 16 19 20 22 23 24
not examined not examined
homogeneousnot examined expression: see section 01
metencephalon
moderate moderate
homogeneousmoderate expression: see section 04 05 21 weak expression: see section 06 07 08 20 22 23
midbrain
moderate moderate
homogeneousmoderate expression: see section 11 12 13 14 15 16 17 18 weak expression: see section 10
kidney calyx
moderate moderate
homogeneousmoderate expression: see section 08 09 10 11 18 19 20 21 22 23
testis
moderate moderate
homogeneousmoderate expression: see section 08 11 12 weak expression: see section 10 not examined expression: see section 18 19 20 21 22 23
lung
moderate moderate
spottedmoderate expression: see section 08 09 10 11 12 13 15 16 19 20 weak expression: see section 06 07 17 18 21 22 23 24
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T2181
Entity Detected:Dnmt3b, DNA methyltransferase 3B ( MGI:1261819)
Sequence:sense strand is shown

>T2181
TGGCCTCGAGCCAGATTCGGCACGAGGGATCGCTTCCTAGAGCTCTTCTACATGTATGATGAGGACGGCT
ATCAGTCCTACTGCACCGTGTGCTGTGAGGGCCGTGAACTGCTGCTGTGCAGTAACACAAGCTGCTGCAG
ATGCTTCTGTGTGGAGTGTCTGGAGGTGCTGGTGGGCGCAGGCACAGCTGAGGATGCCAAGCTGCAGGAA
CCCTGGAGCTGCTATATGTGCCTCCCTCAGCGCTGCCATGGGGTCCTCCGACGCAGGAAAGATTGGAACA
TGCGCCTGCAAGACTTCTTCACTACTGATCCTGACCTGGAAGAATTTCAGGAGCCACCCAAGTTGTACCC
AGCAATTCCTGCAGCCAAAAGGAGGCCCATTAGAGTCCTGTCTCTGTTTGATGGAATTGCAACGGGGTAC
TTGGTGCTCAAGGAGTTGGGTATTAAAGTGGAAAAGTACATTGCCTCCGAAGTCTGTGCAGAGTCCATCG
CTGTGGGAACTGTTAAGCATGAAGGCCAGATCAAATATGTCAATGACGTCCGGAAAATCACCAAGA
Notes:The probe template was PCR amplified from IMAGE:891000 using vector specific primers. Forward Primer - name:RZPD M13 forward, sequence:GCTATTACGCCAGCTGGCGAAAGGGGGATGTG; Reverse Primer - name:RZPD M13 reverse, sequence:CCCCAGGCTTTACACTTTATGCTTCCGGCTCG. Anti-sense probe was then transcribed from the PCR amplified template using T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:891000 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:10592 same embryo
 EMAGE:10591 same embryo
 EMAGE:10590 same embryo
 EMAGE:10587 same embryo
 EMAGE:10589 same embryo
 EurExpress:euxassay_000914 same experiment
 MGI:4824366 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS