Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:10874

Psmb3 proteasome (prosome, macropain) subunit, beta type 3 ( MGI:1347014)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:10874 EMAGE:10874 EMAGE:10874 EMAGE:10874 EMAGE:10874
"Pseudo-wholemount" of euxassay_003314. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_003314_01 euxassay_003314_02 euxassay_003314_03 euxassay_003314_04
EMAGE:10874 EMAGE:10874 EMAGE:10874 EMAGE:10874 EMAGE:10874
euxassay_003314_05 euxassay_003314_06 euxassay_003314_07 euxassay_003314_08 euxassay_003314_09
EMAGE:10874 EMAGE:10874 EMAGE:10874 EMAGE:10874 EMAGE:10874
euxassay_003314_10 euxassay_003314_11 euxassay_003314_12 euxassay_003314_13 euxassay_003314_14
EMAGE:10874 EMAGE:10874 EMAGE:10874 EMAGE:10874 EMAGE:10874
euxassay_003314_15 euxassay_003314_16 euxassay_003314_17 euxassay_003314_18 euxassay_003314_19
EMAGE:10874 EMAGE:10874 EMAGE:10874
euxassay_003314_20 euxassay_003314_21 euxassay_003314_22

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:10874Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
10874_wholemount_strong.wlz
10874_wholemount_moderate.wlz
10874_wholemount_weak.wlz
10874_wholemount_possible.wlz
10874_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:10874_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
thymus primordium
moderate moderate
regionalmoderate expression: see section 09 10 11 12 13
submandibular gland primordium
strong strong
regionalstrong expression: see section 05 06 07 16 17 moderate expression: see section 04 08 14 15
pancreas
moderate moderate
regionalmoderate expression: see section 08 09
vibrissa
moderate moderate
regionalmoderate expression: see section 04 05 06 18 19 20
facial vii ganglion
moderate moderate
regionalmoderate expression: see section 02 03 04 18 19 20
glossopharyngeal ix ganglion
moderate moderate
regionalmoderate expression: see section 05 06 15 16
trigeminal v ganglion
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 15 16 17 18 19 20
vagus x ganglion
moderate moderate
regionalmoderate expression: see section 06 15
dorsal root ganglion
moderate moderate
regionalmoderate expression: see section 09 10 14 15 16 weak expression: see section 07
lower jaw incisor
moderate moderate
regionalmoderate expression: see section 09 10 11 13 14
lower jaw molar
moderate moderate
regionalmoderate expression: see section 05 07 16 17
upper jaw incisor
moderate moderate
regionalmoderate expression: see section 09 10 11 13 14 15
upper jaw molar
moderate moderate
regionalmoderate expression: see section 05 07 16 17
maturing glomerular tuft
moderate moderate
regionalmoderate expression: see section 05 06 07 08 09 15 16 17 18 19 20
orbito-sphenoid
strong strong
regionalstrong expression: see section 01 02 03 04 19 20 21 22
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T6242
Entity Detected:Psmb3, proteasome (prosome, macropain) subunit, beta type 3 ( MGI:1347014)
Sequence:sense strand is shown

>T6242
GGCTTCCACTCCAGCGCAATCATGTCTATTATGTCCTATAATGGAGGGGCCGTCATGGCCATGAAGGGAA
AGAACTGTGTGGCCATCGCTGCAGACAGACGTTTCGGGATCCAGGCCCAGATGGTGACCACGGACTTCCA
GAAGATCTTTCCCATGGGTGACAGGCTCTACATAGGCCTGGCCGGCCTGGCCACTGACGTCCAGACAGTT
GCCCAGCGTCTCAAGTTCCGACTGAACTTGTATGAGCTGAAAGAAGGTCGACAGATCAAGCCTTACACCC
TCATGAGCATGGTGGCCAACCTCCTGTATGAGAAGCGGTTCGGTCCCTACTACACAGAGCCTGTCATTGC
TGGCCTGGACCCGAAGACCTTCAAGCCCTTCATTTGCTCTCTGGACCTCATTGGCTGTCCCATGGTGACT
GATGACTTTGTAGTCAGTGGTACCTGCTCCGAACAAATGTATGGGATGTGTGAGTCTCTCTGGGAGCCCA
ACATGGATCCAGAACACCTGTTTGAAACCATTTCTCAGGCCATGCTGAACGCGGTGGACCGGGATGCCGT
GTCGGGCATGGGCGTCATCGTCCACGTCATTGAGAAAGACAAGATCACCACCAGGACGCTGAAGGCCCGG
ATGGACTAACCTGTGCTCTGGTCCCATCTCCCTTTTGTTTTTCTTTTTAATAAAATCGCCTTTCTTTCAT
GCCAAAAAAAAAAAAAAAAAA
Notes:The probe template was PCR amplified from IMAGE:3500033 using vector (pCMV-SPORT6) specific primers. Forward Primer - name:RZPD T7, sequence:TAATACGACTCACTATAGGG; Reverse Primer - name:RZPD sp6, sequence:ATTTAGGTGACACTATAG. Anti-sense probe was then transcribed from the PCR amplified template using Sp6 polymerase. EMAGE Editor's Note: the probe sequence indicated here was given by the EURExpress Consortium and has been checked using a computational method whereby a BLAST comparison was made against the full insert sequence of IMAGE:3500033 which was retrieved directly from NCBI.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:10871 same embryo
 EMAGE:10869 same embryo
 EMAGE:10873 same embryo
 EMAGE:10870 same embryo
 EMAGE:10872 same embryo
 EurExpress:euxassay_003314 same experiment
 MGI:4827476 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS