EMAGE mouse gene expression spatial database

EMAGE:11454

Tceb2 transcription elongation factor B (SIII), polypeptide 2 ( MGI:1914923)
TS23 (14.5 dpc)
in situ hybridisation

Data Images


"Pseudo-wholemount" of euxassay_006828. This image has been made by aligning and collapsing the constitutent sections. Information about the method.	euxassay_006828_01	euxassay_006828_02	euxassay_006828_03	euxassay_006828_04

euxassay_006828_05	euxassay_006828_06	euxassay_006828_07	euxassay_006828_08	euxassay_006828_09

euxassay_006828_10	euxassay_006828_11	euxassay_006828_12	euxassay_006828_13	euxassay_006828_14

euxassay_006828_15	euxassay_006828_16	euxassay_006828_17	euxassay_006828_18	euxassay_006828_19

euxassay_006828_20	euxassay_006828_21	euxassay_006828_22	euxassay_006828_23	euxassay_006828_24

View assay images:
Expression pattern clarity:
Find spatially similar wholemount expression patterns:

Expression Pattern Description

Spatial Annotation:

Annotation colour key:

wholemount mapping

Download individual expression domains:

Download all expression domains:

Find spatially similar wholemount expression patterns:

Morphological match to the template:

Annotation Validation:

spatial mapping by EMAGE editor

Detection Reagent

Type:	in situ hybridisation probe
Identifier:	T9115
Entity Detected:	Tceb2, transcription elongation factor B (SIII), polypeptide 2 ( MGI:1914923)
Sequence:	sense strand is shown >T9115 GCCGCCGGGATGGACGTGTTTCTCATGATCCGGCGCCACAAGACCACCATCTTTACGGACGCCAAGGAGT CGAGCACCGTGTTCGAACTGAAGCGCATCGTCGAGGGCATCCTCAAGCGGCCGCCAGAGGAGCAGCGGCT TTACAAGGATGACCAGCTCCTTGATGATGGCAAAACTCTGGGCGAGTGTGGCTTCACTAGCCAGACAGCA CGGCCACAGGCCCCAGCCACAGTGGGCCTGGCCTTCCGAGCAGATGACACCTTCGAAGCTCTCCGCATCG AGCCCTTTTCCAGCCCTCCAGAGCTTCCAGATGTGATGAAGCCACAGGATTCTGGAGGCAGTGCCAATGA ACAAGCTGTGCAGTGAGGGCCTAGGCCTACCCCCTAGAGACCCATTTCCCCAATAAAAAAAATTTGGCTG TCTACCTGATTGACTTTTCTGTTCCCTCTTGTTCACAGAACTCTTAACCCCAAGTAAAGACTACAGACCA ATTAAAAAAAAAAAAAAAAAAAAA
Notes:	The probe template was PCR amplified from IMAGE:6823854 using vector (pYX-Asc) specific primers. Forward Primer - name:RZPD T3, sequence:ATTAACCCTCACTAAAGGGA; Reverse Primer - name:RZPD T7, sequence:TAATACGACTCACTATAGGG. Anti-sense probe was then transcribed from the PCR amplified template using T7 polymerase. EMAGE Editor's Note: the probe sequence indicated here was given by the EURExpress Consortium and has been checked using a computational method whereby a BLAST comparison was made against the full insert sequence of IMAGE:6823854 which was retrieved directly from NCBI.
Chemistry:	RNA
Strand:	antisense
Label:	digoxigenin

Specimen

Procedures

Fixation:	none
Embedding:	cryosection (OCT)
Staining procedure:	alkaline phosphatase + NBT/BCIP

General Information

Authors:	Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:	Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:	EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:	screen
References:	[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:	EMAGE:11457 same embryo
	EMAGE:11456 same embryo
	EMAGE:11458 same embryo
	EMAGE:11453 same embryo
	EMAGE:11455 same embryo
	EurExpress:euxassay_006828 same experiment
	Ensembl same gene
	Allen Brain Atlas same gene
	BioGPS same gene
	International Mouse Knockout Project Status same gene
	GEISHA Chicken ISH Database same gene
	EMBL-EBI Gene Expression Atlas same gene
	BrainStars same gene
	ViBrism same gene
Data Source