Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:12524

Grb10 growth factor receptor bound protein 10 ( MGI:103232)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:12524 EMAGE:12524 EMAGE:12524 EMAGE:12524 EMAGE:12524
"Pseudo-wholemount" of euxassay_011372. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_011372_01 euxassay_011372_02 euxassay_011372_03 euxassay_011372_04
EMAGE:12524 EMAGE:12524 EMAGE:12524 EMAGE:12524 EMAGE:12524
euxassay_011372_05 euxassay_011372_06 euxassay_011372_07 euxassay_011372_08 euxassay_011372_09
EMAGE:12524 EMAGE:12524 EMAGE:12524 EMAGE:12524 EMAGE:12524
euxassay_011372_10 euxassay_011372_11 euxassay_011372_12 euxassay_011372_13 euxassay_011372_14
EMAGE:12524 EMAGE:12524 EMAGE:12524 EMAGE:12524 EMAGE:12524
euxassay_011372_15 euxassay_011372_16 euxassay_011372_17 euxassay_011372_18 euxassay_011372_19
EMAGE:12524 EMAGE:12524 EMAGE:12524
euxassay_011372_20 euxassay_011372_21 euxassay_011372_22

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:12524Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
12524_wholemount_strong.wlz
12524_wholemount_moderate.wlz
12524_wholemount_weak.wlz
12524_wholemount_possible.wlz
12524_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:12524_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: three stars
Text Annotation:
StructureLevelPatternNotes
body cavity or lining
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22
limb
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22
mesenchyme
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22
vertebral axis musculature
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22
gland
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22
visceral organ system
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22
nervous system
strong strong
spottedstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 moderate expression: see section 21 22
integumental system
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22
diencephalon lateral wall ventricular layer
strong strong
regionalstrong expression: see section 13 14 15
telencephalon ventricular layer
strong strong
regionalstrong expression: see section 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22
medulla oblongata alar plate ventricular layer
strong strong
regionalstrong expression: see section 06 07 08 09 10 11 12 13 14 15 16 17
medulla oblongata basal plate ventricular layer
strong strong
regionalstrong expression: see section 11 12
rest of cerebellum ventricular layer
strong strong
regionalstrong expression: see section 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19
pons ventricular layer
strong strong
regionalstrong expression: see section 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19
midbrain ventricular layer
strong strong
regionalstrong expression: see section 08 09 10 11 12 13 14 15
spinal cord ventricular layer
strong strong
regionalstrong expression: see section 11 12 13 14
sensory organ system
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22
cardiovascular system
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22
skeleton
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22
tail
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T30150
Entity Detected:Grb10, growth factor receptor bound protein 10 ( MGI:103232)
Sequence:sense strand is shown

>T30150
GCTGTATGTGTGCCTGCGCAGATCTGGCCTCTATTACTCCACCAAGGGGACTTCAAAAGAACCCAGACAC
CTGCAGCTGCTGGCTGACCTGGAAGAAAGCAGCATCTTCTACCTGATTGCTGGAAAGAAGCAGTACAACG
CGCCGAATGAACATGGGATGTGCATCAAGCCAAACAAAGCGAAGACCGAGATGAAGGAGCTTCGTCTGCT
CTGTGCCGAAGATGAGCAGATCCGTACTTGCTGGATGACTGCCTTCAGACTGCTCAAGTACGGAATGCTC
CTGTACCAAAACTATCGCATCCCACAGAGGAAGGGTCTGCCCCCTCCTTTCAACGCACCTATGCGCAGTG
TTTCTGAGAATTCTCTTGTGGCCATGGATTTTTCTGGACAAATCGGAAGAGTGATCGATAACCCGGCTGA
AGCCCAGAGTGCTGCCCTGGAAGAGGGCCATGCCTGGCGTAAGCGGAGCACACGGATGAATATCCTAAGC
AGCCAAAGCCCACTGCATCCTTCTACCCTGAATGCAGTGATTCACAGGACTCAGCATTGGTTCCATGGAC
GTATCTCCCGCGAGGAGTCTCACAGGATCATCAAGCAACAAGGTCTCGTGGACGGGCTGTTCCTCCTTCG
TGACAGCCAGAGTAATCCAAAGGCGTTCGTACTGACACTGTGCCATCACCAGAAGATTAAAAACTTCCAG
ATCTTACCTTGCGAGGATGATGGGCAGACCTTCTTCACTCTGGATGATGGGAACACCAAGTTCTCCGATC
TGATCCAGCTGGTCGACTTCTACCAGCTCAACAAAGGTGTTCTGCCCTGCAAGCTGAAACACCACTGCAT
CCGCGTGGCCTTATGACCTCCTTGCCCACTCACAGAGGCTGGAGGCAGCGACACTGGAA
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from the plasmid IMAGE:4481345), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 9494. Forward Primer - name:ABA_MGC_019_02_F03_F_ACAGTGAGAAGCAGGCCG_ABA_FR_019, sequence:GCTGTATGTGTGCCTGCG; Reverse Primer - name:_R_SP6_ABA_MGC_007_02_A09_GCTGTATGTGTGCCTGCGCAGATC, sequence:GTTCCAGTGTCGCTGCCT. The reverse primer contains a 5' extension containing an SP6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using SP6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:12526 same embryo
 EMAGE:12529 same embryo
 EMAGE:12525 same embryo
 EMAGE:12528 same embryo
 EMAGE:12527 same embryo
 EurExpress:euxassay_011372 same experiment
 MGI:4825215 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS