Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:12923

Tpd52 tumor protein D52 ( MGI:107749)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:12923 EMAGE:12923 EMAGE:12923 EMAGE:12923 EMAGE:12923
"Pseudo-wholemount" of euxassay_013711. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_013711_01 euxassay_013711_02 euxassay_013711_03 euxassay_013711_04
EMAGE:12923 EMAGE:12923 EMAGE:12923 EMAGE:12923 EMAGE:12923
euxassay_013711_05 euxassay_013711_06 euxassay_013711_07 euxassay_013711_08 euxassay_013711_09
EMAGE:12923 EMAGE:12923 EMAGE:12923 EMAGE:12923 EMAGE:12923
euxassay_013711_10 euxassay_013711_11 euxassay_013711_12 euxassay_013711_13 euxassay_013711_14
EMAGE:12923 EMAGE:12923 EMAGE:12923 EMAGE:12923 EMAGE:12923
euxassay_013711_15 euxassay_013711_16 euxassay_013711_17 euxassay_013711_18 euxassay_013711_19
EMAGE:12923 EMAGE:12923 EMAGE:12923 EMAGE:12923
euxassay_013711_20 euxassay_013711_21 euxassay_013711_22 euxassay_013711_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:12923Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
12923_wholemount_strong.wlz
12923_wholemount_moderate.wlz
12923_wholemount_weak.wlz
12923_wholemount_possible.wlz
12923_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:12923_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
thymus primordium
strong strong
regionalstrong expression: see section 13 14 15 moderate expression: see section 10 11 12
submandibular gland primordium
strong strong
regionalstrong expression: see section 07 08 09 15 16 17
pancreas
strong strong
regionalstrong expression: see section 08 09 10 11 14 15 16
thyroid gland
strong strong
regionalstrong expression: see section 10 15 moderate expression: see section 11
pituitary gland
strong strong
regionalstrong expression: see section 08 09 10 11 12 13 14 15 16
vibrissa
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 18 19 20 21 22
medulla oblongata alar plate mantle layer
moderate moderate
regionalmoderate expression: see section 10 15
medulla oblongata basal plate mantle layer
moderate moderate
regionalmoderate expression: see section 09 15
rest of cerebellum mantle layer
strong strong
single cellstrong expression: see section 05 06 07 08 09 10 11 12 15 16 17 18 19
midbrain mantle layer
strong strong
single cellstrong expression: see section 06 07 08 09 10 11 12 15 16 17 18 19
tegmentum
moderate moderate
regionalmoderate expression: see section 13 14
facial vii ganglion
strong strong
regionalstrong expression: see section 03 04 05 06 20 21
glossopharyngeal ix ganglion
strong strong
regionalstrong expression: see section 06 07 18 19
trigeminal v ganglion
strong strong
regionalstrong expression: see section 02 03 04 05 06 07 08 17 18 19 20 21 22
vagus x ganglion
strong strong
regionalstrong expression: see section 17 moderate expression: see section 08
vestibulocochlear viii ganglion
strong strong
regionalstrong expression: see section 17 moderate expression: see section 06 07 18 19 20
ventral grey horn
strong strong
regionalstrong expression: see section 10 11 12 13 14 15 16
dorsal root ganglion
strong strong
regionalstrong expression: see section 08 09 10 11 12 16 17 18
endolymphatic duct
moderate moderate
regionalmoderate expression: see section 01 02 21 22 23
cochlea
moderate moderate
regionalmoderate expression: see section 06 07 17 18 19
utricle
moderate moderate
regionalmoderate expression: see section 02 03 04 05 06 07 18 19 20 21
pharyngo-tympanic tube
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 08 19 20 21 22 23
cornea epithelium
moderate moderate
regionalmoderate expression: see section 02 03 21 22 23
retina
moderate moderate
regionalmoderate expression: see section 01
neural retina
moderate moderate
regionalmoderate expression: see section 02 21 22 23
anterior naris epithelium
strong strong
regionalstrong expression: see section 13 moderate expression: see section 09 10 11 12 14
external naris epithelium
strong strong
regionalstrong expression: see section 13 moderate expression: see section 09 14
nasal cavity olfactory epithelium
strong strong
regionalstrong expression: see section 06 07 08 09 10 13 14 15 16 17
naso-lacrimal duct
strong strong
regionalstrong expression: see section 04 05 06 07 16 17 18 19 20 21 22
vomeronasal organ
strong strong
regionalstrong expression: see section 10 13
esophagus epithelium
strong strong
regionalstrong expression: see section 12 13
pharynx epithelium
strong strong
regionalstrong expression: see section 11 12 13 14
stomach
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10
rectum
strong strong
regionalstrong expression: see section 13 14
midgut
strong strong
regionalstrong expression: see section 06 07 08 09 10 11 12 13 14 15 16 17 18
bladder
strong strong
regionalstrong expression: see section 12 13
renal cortex
strong strong
regionalstrong expression: see section 07 08 09 10 16 17 18 19 20
seminiferous cord
strong strong
regionalstrong expression: see section 05 06 07 18 19 20 21
larynx
strong strong
regionalstrong expression: see section 12 13
left lung
strong strong
regionalstrong expression: see section 04 05 06 07 08 09 10 11 12 13
right lung
strong strong
regionalstrong expression: see section 14 15 16 17 18 19 20 21 22
trachea epithelium
strong strong
regionalstrong expression: see section 12 13 14
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T31665
Entity Detected:Tpd52, tumor protein D52 ( MGI:107749)
Sequence:sense strand is shown

>T31665
GCATTTTCATCGGTTGGCTCAGTCATCACCAAAAAGCTGGAAGACGTGAAAAACTCCCCAACTTTCAAGT
CATTTGAAGAAAAAGTTGAAAATTTAAAGTCTAAAGTAGGAGGAGCCAAGCCTGCTGGCGGCGATTTTGG
AGAAGTCCTGAATTCCACAGCCAACGCTACCAGTACCATGACCACAGAGCCTCCTCCAGAACAGATGACA
GAGAGCCCCTGAGCTGCCGACCTGTGTCCTGCTGCCCACTGCCAGGTGCTGCCGGCGAGAGCCAAGCACA
TCTTGACAACGCTCATGGCTGCGGATTTCCACCAGATGTGCTTTTATTTAGCTTTACTTATTTCTTTGAC
CAAATAGTTGATGAATGAAACAAAGTGAAATCACTTGACCTCCACTCCAGGGAAACACTGTTAGCATGCA
TGGAAGGCCCTTTGTATAGGAAACAGCATCATAGAGCCTCTGGTAGATCCCTGCAGGCAACTACTGTGTT
TCTCCTTAAAATCACTGTACATCTGGATTCTAGTTTGATCTTTCTTTACTATCTACATGAATCATTGTTT
TTGGGTCTCTGTACACTTAATCAATTTCTAACAAACTGTCCTTTTCTAAATTCTGGTTATTAAAAGTCTT
GGAATTATTTCATTCCTTTCAAAGGAGAAACTACCAGCTACATTTTTTTTTTCTCGGATAAACAGTTCTA
TGAGGACCATATCTTGGGTTTCTAAAGACACCAGACTAAAGTAGAAAGGTGTGTATGCAGTTCTATAGTT
CTGTAAATTAAAAACATGCAGACACTCAAACTTCCAGTGGGGAGAGTGTGG
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from the plasmid IMAGE:3590969), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 14877. Forward Primer - name:014877_F_IRAV08-11_O07_Tpd52, sequence:GCATTTTCATCGGTTGGC; Reverse Primer - name:014877_R_SP6_IRAV08-11_O07_Tpd52, sequence:CCCACACTCTCCCCACTG. The reverse primer contains a 5' extension containing an SP6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using SP6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:12922 same embryo
 EMAGE:12921 same embryo
 EMAGE:12924 same embryo
 EMAGE:12919 same embryo
 EMAGE:12920 same embryo
 EurExpress:euxassay_013711 same experiment
 MGI:4828875 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS