Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:13676

Mir181a-2 microRNA 181a-2 ( MGI:2676845)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:13676 EMAGE:13676 EMAGE:13676 EMAGE:13676 EMAGE:13676
"Pseudo-wholemount" of euxassay_019218. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_019218_01 euxassay_019218_02 euxassay_019218_03 euxassay_019218_04
EMAGE:13676 EMAGE:13676 EMAGE:13676 EMAGE:13676 EMAGE:13676
euxassay_019218_05 euxassay_019218_06 euxassay_019218_07 euxassay_019218_08 euxassay_019218_09
EMAGE:13676 EMAGE:13676 EMAGE:13676 EMAGE:13676 EMAGE:13676
euxassay_019218_10 euxassay_019218_11 euxassay_019218_12 euxassay_019218_13 euxassay_019218_14
EMAGE:13676 EMAGE:13676 EMAGE:13676 EMAGE:13676 EMAGE:13676
euxassay_019218_15 euxassay_019218_16 euxassay_019218_17 euxassay_019218_18 euxassay_019218_19
EMAGE:13676 EMAGE:13676 EMAGE:13676 EMAGE:13676 EMAGE:13676
euxassay_019218_20 euxassay_019218_21 euxassay_019218_22 euxassay_019218_23 euxassay_019218_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:13676Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
13676_wholemount_strong.wlz
13676_wholemount_moderate.wlz
13676_wholemount_weak.wlz
13676_wholemount_possible.wlz
13676_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:13676_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
intermediate grey horn
weak weak
regionalweak expression: see section 18
lower lip
weak weak
regionalweak expression: see section 19
upper lip
moderate moderate
regionalmoderate expression: see section 12 13 15 16 weak expression: see section 10 11 14 17 18 19
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T70291
Entity Detected:Mir181a-2, microRNA 181a-2 ( MGI:2676845)
Sequence:sense strand is shown

>T70291
AACATTCAACGCTGTCGGTGAGT
Notes:The probe used by the EURExpress consortium to detect the presence of miRNA mmu-miR-181a was custom designed and ordered from Sigma-Exiqon by the EURExpress partner in Geneva and then distributed to the ISH generating units within the consortium.
Chemistry:LNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:13675 same assay
 EMAGE:13678 same embryo
 EMAGE:13674 same embryo
 EurExpress:euxassay_019218 same experiment
 EMAGE:13677 same embryo
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS