Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:14000

Vps37b vacuolar protein sorting 37B (yeast) ( MGI:1916724)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:14000 EMAGE:14000 EMAGE:14000 EMAGE:14000 EMAGE:14000
"Pseudo-wholemount" of euxassay_001738. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_001738_01 euxassay_001738_02 euxassay_001738_03 euxassay_001738_04
EMAGE:14000 EMAGE:14000 EMAGE:14000 EMAGE:14000 EMAGE:14000
euxassay_001738_05 euxassay_001738_06 euxassay_001738_07 euxassay_001738_08 euxassay_001738_09
EMAGE:14000 EMAGE:14000 EMAGE:14000 EMAGE:14000 EMAGE:14000
euxassay_001738_10 euxassay_001738_11 euxassay_001738_12 euxassay_001738_13 euxassay_001738_14
EMAGE:14000 EMAGE:14000 EMAGE:14000 EMAGE:14000 EMAGE:14000
euxassay_001738_15 euxassay_001738_16 euxassay_001738_17 euxassay_001738_18 euxassay_001738_19
EMAGE:14000 EMAGE:14000 EMAGE:14000 EMAGE:14000 EMAGE:14000
euxassay_001738_20 euxassay_001738_21 euxassay_001738_22 euxassay_001738_23 euxassay_001738_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:14000Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
14000_wholemount_strong.wlz
14000_wholemount_moderate.wlz
14000_wholemount_weak.wlz
14000_wholemount_possible.wlz
14000_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:14000_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
diencephalon lateral wall ventricular layer
moderate moderate
regionalmoderate expression: see section 12 13 14 15
telencephalon ventricular layer
moderate moderate
homogeneousmoderate expression: see section 03 04 05 06 07 08 09 10 12 13 14 15 16 17 18 19 20 weak expression: see section 24
medulla oblongata alar plate ventricular layer
moderate moderate
regionalmoderate expression: see section 08 09 10 11 15 16 17 18
medulla oblongata basal plate ventricular layer
moderate moderate
regionalmoderate expression: see section 11 12 13 14 15
metencephalon rest of alar plate ventricular layer
moderate moderate
regionalmoderate expression: see section 04 05 06 07 08 09 10 18 19 20 22
pons ventricular layer
moderate moderate
regionalmoderate expression: see section 08 09 10 11 12 13 14 15 16 17 18 19
midbrain ventricular layer
moderate moderate
regionalmoderate expression: see section 09 10 11 12 13 14 15 16 17 18 19
spinal cord ventricular layer
moderate moderate
regionalmoderate expression: see section 12 13 14
vault of skull
moderate moderate
regionalmoderate expression: see section 02 03 05 09 weak expression: see section 04 24
orbito-sphenoid
moderate moderate
regionalmoderate expression: see section 02 03 05 06 17 18 weak expression: see section 04 20 22 24
viscerocranium
moderate moderate
regionalExpression in the turbinate bone.
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T2694
Entity Detected:Vps37b, vacuolar protein sorting 37B (yeast) ( MGI:1916724)
Sequence:sense strand is shown

>T2694
ATTCAGGGAAACTTTTTTTAAAATGCAGATACTGTTTTGAGCTGGTTTAAAAAATGCAGATTTATTGAGT
GCCGCTTCCTGTCGGGCAAGCAGTGCACGGTCACATCTGCCAGTGCCCGTGCTGTGCCTTAGCTTCACTG
GTGCCAGGACTCGGAGCCCGCGGCGTGCCAGCCGCAGCTGCCCTATGGAGCCGAAGACCAGCTAGGTAGG
GCCTGGCGGGCCTCGTCACTTTGTGATGGGTCAGGAGTGGTCCATCTTCCTCCACCCCGGATAATCTCAG
GAGCAATGCTGCAGGTGCTGGCGTAGGCATGGGAGGGGTTTGGGGACAGCCCGCCCCACAGGGTTGGCAG
TGGCCGCTCCCTCCTCTCTGGGATGTCATCTGCAGGTGCCACATGTGCAGAGTTCCCAGGGCCCGGCTGG
GGAGGGGCAGCCCCACACCTGTTCCCAGAAGAGGGCTGCGAGCCTGTTGGTAGAACTTAGAACCCCACCT
TCACCCTGCCAGCTGGCTACAGCCC
Notes:The probe template was PCR amplified from IMAGE:1512097 using vector specific primers. Forward Primer - name:RZPD M13 forward, sequence:GCTATTACGCCAGCTGGCGAAAGGGGGATGTG; Reverse Primer - name:RZPD M13 reverse, sequence:CCCCAGGCTTTACACTTTATGCTTCCGGCTCG. Anti-sense probe was then transcribed from the PCR amplified template using T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:1512097 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:14001 same embryo
 EMAGE:14002 same embryo
 EMAGE:14004 same embryo
 EMAGE:14003 same embryo
 EMAGE:14005 same embryo
 EurExpress:euxassay_001738 same experiment
 MGI:4829172 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS