Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:14296

Fxyd3 FXYD domain-containing ion transport regulator 3 ( MGI:107497)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:14296 EMAGE:14296 EMAGE:14296 EMAGE:14296 EMAGE:14296
"Pseudo-wholemount" of euxassay_004106. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_004106_01 euxassay_004106_02 euxassay_004106_03 euxassay_004106_04
EMAGE:14296 EMAGE:14296 EMAGE:14296 EMAGE:14296 EMAGE:14296
euxassay_004106_05 euxassay_004106_06 euxassay_004106_07 euxassay_004106_08 euxassay_004106_09
EMAGE:14296 EMAGE:14296 EMAGE:14296 EMAGE:14296 EMAGE:14296
euxassay_004106_10 euxassay_004106_11 euxassay_004106_12 euxassay_004106_13 euxassay_004106_14
EMAGE:14296 EMAGE:14296 EMAGE:14296 EMAGE:14296 EMAGE:14296
euxassay_004106_15 euxassay_004106_16 euxassay_004106_17 euxassay_004106_18 euxassay_004106_19
EMAGE:14296 EMAGE:14296 EMAGE:14296 EMAGE:14296 EMAGE:14296
euxassay_004106_20 euxassay_004106_21 euxassay_004106_22 euxassay_004106_23 euxassay_004106_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:14296Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
14296_wholemount_strong.wlz
14296_wholemount_moderate.wlz
14296_wholemount_weak.wlz
14296_wholemount_possible.wlz
14296_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:14296_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
thymus primordium
moderate moderate
regionalmoderate expression: see section 13 14 15 16
submandibular gland primordium
moderate moderate
regionalmoderate expression: see section 07 08 09 10 18 19 20
vibrissa
moderate moderate
regionalmoderate expression: see section 03 04 05 18 19 20
nasal cavity olfactory epithelium
weak weak
regionalweak expression: see section 07 08 09 10 15 16 17
nasal cavity respiratory epithelium
moderate moderate
regionalmoderate expression: see section 10 11 12 13 14
esophagus
moderate moderate
regionalmoderate expression: see section 14
pharynx epithelium
moderate moderate
regionalmoderate expression: see section 12 13 14 15 16
tongue epithelium
moderate moderate
regionalmoderate expression: see section 09 10 11 12 13 14 15 16
stomach
strong strong
regionalstrong expression: see section 03 04 05 06 07 08 09 10 11
rectum
moderate moderate
regionalmoderate expression: see section 13
midgut
moderate moderate
regionalmoderate expression: see section 12 13 14 weak expression: see section 15 16 17 18 19
oral epithelium
moderate moderate
regionalmoderate expression: see section 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19
bladder
strong strong
regionalstrong expression: see section 11 12 13 14
genital tubercle of male
moderate moderate
regionalmoderate expression: see section 10 11 12 13 14 15 16
urethra of male
strong strong
regionalstrong expression: see section 11 12 13
trachea
moderate moderate
regionalmoderate expression: see section 15
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T5587
Entity Detected:Fxyd3, FXYD domain-containing ion transport regulator 3 ( MGI:107497)
Sequence:sense strand is shown

>T5587
GCTGCTTTCTCCCGGAACCACCTCTCAGCCTGTTGAGCTACTCAGGTCAAGGCTTTGACATGCAAGAGGT
TGTTCTGAGCCTGTTGGTCCTTCTAGCAGGCCTGCCTACTTTGGATGCCAATGACCCTGAAAATAAAAAT
GATCCTTTCTACTATGATTGGTACAGCCTCCGAGTCGGCGGGCTCATTTGTGCAGGGATTCTCTGTGCCC
TGGGCATTATAGTCCTTATGAGTGGCAAATGCAAATGCAAGTTCAGACAGAAACCCAGTCACCGCCCAGG
AGAAGGGCCACCTCTCATCACACCAGGCTCAGCTCACAACTGCTGAAGATGGACCAGTTAAAAGAGCACA
GGTCCTGGCTCTGAAGGTGGGCTTGAACTCCGAGCTGGCTGTTCTCCTCCCCTCCTGACACTGCCTTCCC
CGAGCCTCATCTCACCCCTCGTGGTAGCAGGCTCTTTGTTCAGTTTTTAATATAAAATGATTTCACATCA
AAAAAAAAAAAAAAA
Notes:The probe template was PCR amplified from IMAGE:6485767 using vector (pCMV-SPORT6) specific primers. Forward Primer - name:RZPD T7, sequence:TAATACGACTCACTATAGGG; Reverse Primer - name:RZPD sp6, sequence:ATTTAGGTGACACTATAG. Anti-sense probe was then transcribed from the PCR amplified template using Sp6 polymerase. EMAGE Editor's Note: the probe sequence indicated here was given by the EURExpress Consortium and has been checked using a computational method whereby a BLAST comparison was made against the full insert sequence of IMAGE:6485767 which was retrieved directly from NCBI.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:14300 same embryo
 EMAGE:14297 same embryo
 EMAGE:14299 same embryo
 EMAGE:14301 same embryo
 EMAGE:14298 same embryo
 EurExpress:euxassay_004106 same experiment
 MGI:4824949 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS