Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:14983

Dos downstream of Stk11 ( MGI:1354170)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:14983 EMAGE:14983 EMAGE:14983 EMAGE:14983 EMAGE:14983
"Pseudo-wholemount" of euxassay_008014. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_008014_01 euxassay_008014_02 euxassay_008014_03 euxassay_008014_04
EMAGE:14983 EMAGE:14983 EMAGE:14983 EMAGE:14983 EMAGE:14983
euxassay_008014_05 euxassay_008014_06 euxassay_008014_07 euxassay_008014_08 euxassay_008014_09
EMAGE:14983 EMAGE:14983 EMAGE:14983 EMAGE:14983 EMAGE:14983
euxassay_008014_10 euxassay_008014_11 euxassay_008014_12 euxassay_008014_13 euxassay_008014_14
EMAGE:14983 EMAGE:14983 EMAGE:14983 EMAGE:14983 EMAGE:14983
euxassay_008014_15 euxassay_008014_16 euxassay_008014_17 euxassay_008014_18 euxassay_008014_19
EMAGE:14983 EMAGE:14983 EMAGE:14983 EMAGE:14983
euxassay_008014_20 euxassay_008014_21 euxassay_008014_22 euxassay_008014_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:14983Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
14983_wholemount_strong.wlz
14983_wholemount_moderate.wlz
14983_wholemount_weak.wlz
14983_wholemount_possible.wlz
14983_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:14983_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
diencephalon
moderate moderate
regionalmoderate expression: see section 04 05 06 07 08 09 10 11 12 13 14 15 16 17
telencephalon
moderate moderate
regionalmoderate expression: see section 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 23 weak expression: see section 01 02 22
hindbrain
moderate moderate
regionalmoderate expression: see section 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 weak expression: see section 02
midbrain
moderate moderate
regionalmoderate expression: see section 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17
facial vii ganglion
moderate moderate
regionalmoderate expression: see section 03 04 05 18
glossopharyngeal ix ganglion
moderate moderate
regionalmoderate expression: see section 05 06 15 16
trigeminal v ganglion
moderate moderate
regionalmoderate expression: see section 03 04 05 06 07 08 16 17 18 19 20 21
vestibulocochlear viii ganglion
moderate moderate
regionalmoderate expression: see section 05 weak expression: see section 16 17
trigeminal v nerve
moderate moderate
regionalmoderate expression: see section 09 16
spinal cord
moderate moderate
regionalmoderate expression: see section 05 06 07 08 09 10 11 12
dorsal root ganglion
moderate moderate
regionalmoderate expression: see section 04 05 06 07 13 14 weak expression: see section 08 12
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T36301
Entity Detected:Dos, downstream of Stk11 ( MGI:1354170)
Sequence:sense strand is shown

>T36301
TACAGATGGACAGTGGCTATGCGAGCATCGAGGGGCGCGGAGCAGGCGACGAAGTTTCAGAACTTCCTGC
TCCAGCCCGCAGTCCTCCCCGCAGCCCGCGAGCCTGGCCACGCAGGCCGCGCCGCGATTACAGCATCGAC
GAGAAGACGGACGCTCTTTTCCATGAGTTCCTGCGCCATGACCCTCATTTTGACGATGCACCGCGTCACC
GCACACGTGCACATCCTCACACTCATGCGCGGAAGCAATGGCAACAGAGAGGACGGCAGCACAGCGACCC
CGGTGGTGCACGTGCAGCCACGCCCCCTGGAGTGGCCCGCCCTACACGTGCGCCATTACGCCGTGGGGAC
AGCGTTGATTGTCCTCCTGAAGGCCGTGCGCTGCCCATCACGGGTGATGACCCATCCATTCCTGTCATCG
AGGAGGAGCCTGGCGGTGGAGGCGGTGGTTGCCCAGGCTCTGGGTTGTGCGTTGAGCCCGCCGGGGCCCT
GCTAGACAAGCTAGCAGCCAGCCTCGACGAGAGACTCTTCTCTCCCCGTCTTGCTGAGCCAGTTGCCTCA
TCCCAGGTGCTGATTGTCGCTGCTGCTGCCCCTACATCCCCTGACCACAGCCCGGCCTAAGCTCTGTACT
GGACCTGCCTCTCTGCTGCTTCTCCGGCAGCACATGGGGCTGCTGTGGGAATGGTGGCAACAGCGGGAGC
AACCTGAGGTGGCCGTGCATGGGTACACGGCCCCCAAATCCCAAGTGTGCACATATAGTGT
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 82741. Forward Primer - name:082741_F_cDNA_Dos, sequence:TACAGATGGACAGTGGCTATGC; Reverse Primer - name:082741_N_SP6_cDNA_Dos, sequence:ACACTATATGTGCACACTTGGGA. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:14979 same embryo
 EMAGE:14980 same embryo
 EMAGE:14978 same embryo
 EMAGE:14982 same embryo
 EMAGE:14981 same embryo
 EurExpress:euxassay_008014 same experiment
 MGI:4824375 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS