EMAGE mouse gene expression spatial database

EMAGE:15365

Pkm2 pyruvate kinase, muscle ( MGI:97591)
TS23 (14.5 dpc)
in situ hybridisation

Data Images


"Pseudo-wholemount" of euxassay_010564. This image has been made by aligning and collapsing the constitutent sections. Information about the method.	euxassay_010564_01	euxassay_010564_02	euxassay_010564_03	euxassay_010564_04

euxassay_010564_05	euxassay_010564_06	euxassay_010564_07	euxassay_010564_08	euxassay_010564_09

euxassay_010564_10	euxassay_010564_11	euxassay_010564_12	euxassay_010564_13	euxassay_010564_14

euxassay_010564_15	euxassay_010564_16	euxassay_010564_17	euxassay_010564_18	euxassay_010564_19

euxassay_010564_20	euxassay_010564_21	euxassay_010564_22	euxassay_010564_23	euxassay_010564_24

View assay images:
Expression pattern clarity:
Find spatially similar wholemount expression patterns:

Expression Pattern Description

Spatial Annotation:

Annotation colour key:

wholemount mapping

Download individual expression domains:

Download all expression domains:

Find spatially similar wholemount expression patterns:

Morphological match to the template:

Text Annotation:

Structure

Level

Pattern

Notes

embryo

strong

ubiquitous

strong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24

Annotation Validation:

spatial mapping by EMAGE editor, text annotation by author

Detection Reagent

Type:	in situ hybridisation probe
Identifier:	T30822
Entity Detected:	Pkm2, pyruvate kinase, muscle ( MGI:97591)
Sequence:	sense strand is shown >T30822 CATTAGGCCAGCAACGCTTGTAGTGCTCACTCTGGGCCATAGTGTGGCGCTGGTGGGCTGGGACACCAGG GAAAATTAATGCCTCTAAAACATGCAATAGAGACCAGCTATTATTCAGGGCCCTACCTGAGCCAGGGGTG GAGGAGGAATGCAGGACTGGAAACCCTGACTTTATCACAGAAGGGCGGCAGCATCTCTGGGCTTTGCTTC TGTAGAAAGTTGTCAGAATTCCCAGCCCTAGCCTGGAGTCAGGAGACAGCAAAAGAGTAGGGGCTGAGGG TGTGGGGCCCAGGGTCCCAGTGTAGATGACGACTTCTGGCCCTGGCCCTGACCTGCTTTCCCAACAGCTT TGGCCTCCCCACTTCTTGTGCACTCCACTTCTGTCACTGCAGACACTCCACTCTCCACCTTGTATTCTGC AGAGTCTCCAGGCCTGTTGCTATAGTGCCCACCTGAATGTCA
Notes:	The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from the plasmid IMAGE:3598842), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 16185. Forward Primer - name:016185_F_IRAV16-19_P08_Pkm2, sequence:CATTAGGCCAGCAACGCT; Reverse Primer - name:016185_R_SP6_IRAV16-19_P08_Pkm2, sequence:TTGACATTCAGGTGGGCA. The reverse primer contains a 5' extension containing an SP6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using SP6 polymerase.
Chemistry:	RNA
Strand:	antisense
Label:	digoxigenin

Specimen

Procedures

Fixation:	none
Embedding:	cryosection (OCT)
Staining procedure:	alkaline phosphatase + NBT/BCIP

General Information

Authors:	Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:	Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:	EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:	screen
References:	[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:	EMAGE:15368 same embryo
	EMAGE:15366 same embryo
	EMAGE:15367 same embryo
	EMAGE:15370 same embryo
	EMAGE:15369 same embryo
	EurExpress:euxassay_010564 same experiment
	MGI:4827233 same experiment
	Ensembl same gene
	Allen Brain Atlas same gene
	BioGPS same gene
	International Mouse Knockout Project Status same gene
	GEISHA Chicken ISH Database same gene
	EMBL-EBI Gene Expression Atlas same gene
	BrainStars same gene
	ViBrism same gene
Data Source