Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:15366

Sgk1 serum/glucocorticoid regulated kinase 1 ( MGI:1340062)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:15366 EMAGE:15366 EMAGE:15366 EMAGE:15366 EMAGE:15366
"Pseudo-wholemount" of euxassay_010543. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_010543_01 euxassay_010543_02 euxassay_010543_03 euxassay_010543_04
EMAGE:15366 EMAGE:15366 EMAGE:15366 EMAGE:15366 EMAGE:15366
euxassay_010543_05 euxassay_010543_06 euxassay_010543_07 euxassay_010543_08 euxassay_010543_09
EMAGE:15366 EMAGE:15366 EMAGE:15366 EMAGE:15366 EMAGE:15366
euxassay_010543_10 euxassay_010543_11 euxassay_010543_12 euxassay_010543_13 euxassay_010543_14
EMAGE:15366 EMAGE:15366 EMAGE:15366 EMAGE:15366 EMAGE:15366
euxassay_010543_15 euxassay_010543_16 euxassay_010543_17 euxassay_010543_18 euxassay_010543_19
EMAGE:15366 EMAGE:15366 EMAGE:15366
euxassay_010543_20 euxassay_010543_21 euxassay_010543_22

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:15366Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
15366_wholemount_strong.wlz
15366_wholemount_moderate.wlz
15366_wholemount_weak.wlz
15366_wholemount_possible.wlz
15366_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:15366_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
medulla oblongata part of 4th ventricle choroid plexus
moderate moderate
spottedmoderate expression: see section 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20
interdigital region between forelimb digits 2 and 3 mesenchyme
moderate moderate
spottedmoderate expression: see section 03 06 07 08
interdigital region between forelimb digits 3 and 4 mesenchyme
moderate moderate
spottedmoderate expression: see section 03 04 05 06 07 08
interdigital region between forelimb digits 4 and 5 mesenchyme
moderate moderate
spottedmoderate expression: see section 03 04 05 06 07 08
interdigital region between hindlimb digits 1 and 2 mesenchyme
moderate moderate
spottedmoderate expression: see section 04 05 06 22
interdigital region between hindlimb digits 2 and 3 mesenchyme
moderate moderate
spottedmoderate expression: see section 04 05 06 22
interdigital region between hindlimb digits 3 and 4 mesenchyme
moderate moderate
spottedmoderate expression: see section 04 05 06 20 22
interdigital region between hindlimb digits 4 and 5 mesenchyme
moderate moderate
spottedmoderate expression: see section 04 05 06 20 22
mesenchyme
moderate moderate
spottedmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22
adrenal gland
moderate moderate
spottedmoderate expression: see section 04 05 06 07 13 14 15 16
vibrissa
moderate moderate
regionalmoderate expression: see section 06 07 08 09
diencephalon roof plate
moderate moderate
spottedmoderate expression: see section 12 13
choroid invagination
moderate moderate
spottedmoderate expression: see section 06 07 08 09 10 14 15 16 17 18
metencephalon part of 4th ventricle choroid plexus
moderate moderate
spottedmoderate expression: see section 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20
lower lip
moderate moderate
regionalmoderate expression: see section 08 09 10 20 21 22
upper lip
moderate moderate
regionalmoderate expression: see section 08 22
renal medullary interstitium
moderate moderate
spottedmoderate expression: see section 04 05 06 07 14 15 16 17
left lung
moderate moderate
spottedmoderate expression: see section 02 03 04 05 06 07 08 09
right lung
moderate moderate
spottedmoderate expression: see section 10 11 12 13 14 15 16 17 18 19 20 21
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T30820
Entity Detected:Sgk1, serum/glucocorticoid regulated kinase 1 ( MGI:1340062)
Sequence:sense strand is shown

>T30820
GCACCTCCTGTGGATTCCTTCCTCTGAGTGCTCCCGGGATGGTTCTGAAGGACTTCCTCAGCGTTTCCTA
AAGTGTTTTCGTTAGCCTTTGGTGGAGTTGCCAGCTGACAGAACATTTTAAAAGAATTTGCACACCTGGA
AGCTTGGCAGTCTCGCCTGCCCGGCGTGGCGCGACGCAGCGCGCGCTGCTTGATGGGAGCTTTCCGAAGA
GCACACCCTCCTCTCAATGAGCTTGTGAGGTCTTCTTTTCTTCTCTTCCTTCCAACGTGGTGCTAGCTCC
AGGCGAGCGAGCGTGAGAGTGCCGCCTGAGACAGACACCTTGGTCTCAGTTAGAAGGAAGATGCAGGTCT
AAGAGGAATCCCCGCAGGTCTGTCTGAGCTGTGATCAAGAATATTCTGCAATGTGCCTTTTCTGAGATCG
TGTTAGCTCCAAAGCTTTTTCCTATCGCAGAGTGTTCAGTTTGTGTTTGTTTGTTTTTGTTTTGTTTTGT
TTTTCCCTTGGCGGATTTCCCGTGTGTGCAGTGGCGTGAGTGTGCTATGCCTGATCACAGACGGTTTTGT
TGTGAGCATCAATGTGACACTTGCAGGACACTACAATGTGGGACATTGTTTGTTTCTTCCACATTTGGAA
GATAAATTTATGTGTAGACTGTTTTGTAAGATATAGTTAATAACTAAAACCTATTGAAACGGTCTTGCAA
TGACGAGCATTCAGATGCTTAAGGAAAGCATTGCTGCTACAAATATTTCTATTTTTAGAAAGGGTTTTTA
TGGACCAATGCCCCAGTTGTCAGTCAAAGCCGTTGGTGTTTTCATT
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from the plasmid IMAGE:3594892), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 16010. Forward Primer - name:016010_F_IRAV16-19_O13_Sgk, sequence:GCACCTCCTGTGGATTCCT; Reverse Primer - name:016010_R_SP6_IRAV16-19_O13_Sgk, sequence:CAATGAAAACACCAACGGC. The reverse primer contains a 5' extension containing an SP6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using SP6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:15368 same embryo
 EMAGE:15367 same embryo
 EMAGE:15370 same embryo
 EMAGE:15365 same embryo
 EMAGE:15369 same embryo
 EurExpress:euxassay_010543 same experiment
 MGI:4828024 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS