Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:15436

Car11 carbonic anhydrase 11 ( MGI:1336193)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:15436 EMAGE:15436 EMAGE:15436 EMAGE:15436 EMAGE:15436
"Pseudo-wholemount" of euxassay_010644. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_010644_01 euxassay_010644_02 euxassay_010644_03 euxassay_010644_04
EMAGE:15436 EMAGE:15436 EMAGE:15436 EMAGE:15436 EMAGE:15436
euxassay_010644_05 euxassay_010644_06 euxassay_010644_07 euxassay_010644_08 euxassay_010644_09
EMAGE:15436 EMAGE:15436 EMAGE:15436 EMAGE:15436 EMAGE:15436
euxassay_010644_10 euxassay_010644_11 euxassay_010644_12 euxassay_010644_13 euxassay_010644_14
EMAGE:15436 EMAGE:15436 EMAGE:15436 EMAGE:15436 EMAGE:15436
euxassay_010644_15 euxassay_010644_16 euxassay_010644_17 euxassay_010644_18 euxassay_010644_19
EMAGE:15436 EMAGE:15436 EMAGE:15436 EMAGE:15436
euxassay_010644_20 euxassay_010644_21 euxassay_010644_22 euxassay_010644_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:15436Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
15436_wholemount_strong.wlz
15436_wholemount_moderate.wlz
15436_wholemount_weak.wlz
15436_wholemount_possible.wlz
15436_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:15436_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
diencephalon lateral wall mantle layer
weak weak
single cellweak expression: see section 07 08 09 10 12 14 15
telencephalon mantle layer
moderate moderate
regionalmoderate expression: see section 02 03 04 05 06 07 19 20 22 23 weak expression: see section 21
olfactory cortex marginal layer
moderate moderate
regionalmoderate expression: see section 10 11 12 13 15 16 17 18 19
rest of cerebellum mantle layer
moderate moderate
single cellmoderate expression: see section 03 04 05 weak expression: see section 16
midbrain mantle layer
moderate moderate
single cellmoderate expression: see section 03 04 weak expression: see section 06 07 08 09 10 11 12 14 15 16
midbrain marginal layer
moderate moderate
single cellmoderate expression: see section 05
facial vii ganglion
moderate moderate
regionalmoderate expression: see section 03 04
trigeminal v ganglion
moderate moderate
regionalmoderate expression: see section 02 03 04 07 08 19 20 weak expression: see section 16 17 18 21
dorsal root ganglion
moderate moderate
single cellmoderate expression: see section 06 07 12 13 14 15 weak expression: see section 08
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T31189
Entity Detected:Car11, carbonic anhydrase 11 ( MGI:1336193)
Sequence:sense strand is shown

>T31189
AGAAGGGGTGTGCATTGGCACCGAGAGGGACCCGGGGCCGGCGAGGGCGATCGCAGCTTCGGGAGGTAGA
GCGAGTGCAGGGAGCGGGCCCAGGCGGGCGGAGGAGTGAGCGTCAAACGGGCTCTGGGGTACACGGTCCC
AGCCCCTGTATCCCGGGAGCTGGGGCTCCCGTTCTGGTGACAGCCAGGCTGGAAGTCCCAAGAGGAGGGG
AGGGAAGAGCTAGGGGGTCGGGCGCTGGGAAAGGGTCGCTCCGAGGCCTCTTGGATGGGGGGTGCCGCTC
GCCTGAGCGCCCCTCAAGCGCTGGTACTCTGGGCCGCACTGGGAGCGGCAGCTCACATCGGACCTGCACC
TGATCCCGAGGACTGGTGGAGCTACAAGGAGAATCTCCAGGGAAACTTCGTGCCAGGGCCTCCCTTCTGG
GGCCTGGTGAACGCTGCCTGGAGCCTGTGCGCTGTGGGGAAGCGGCAGAGCCCCGTGGATGTGGAGCTGA
AGCGGGTTCTTTATGACCCTTTTCTGCCCCCGCTCAGACTCAGCACCGGGGGAGAGAAGCTCCGGGGAAC
CTTGTACAACACTGGCCGCCATGTCTCCTTCCTACCTGCATCCCGACCTGTGGTCAACGTGTCTGGGGGT
CCCCTTCTTTATAGCCACCGACTCAGTGAACTGCGCCTGCTATTTGGAGCTCGAGATGGTGCCGGCTCTG
AACACCAGATCAACCATGAAGGCTTCTCCGCTGAGGTGCAGCTAATCCACTTCAACCAAGAACTCTATGG
GAACCTCAGTGCTGCCTCAAGGGGCCCCAACGGCCTGGCCATTCTCAGCCTCTTTGTCAATGTGGCTGGC
AGTTCCAACCCATTCCTCAGTCGCCTCCTCAACCGGGACACTATCACCCGAATCTCCTACAAAAATGATG
CCTACTTTCTTCAAGACCTGAGCCTGGAGCTCCTGTTCCCAGAATCCTTCGGCT
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from the plasmid IMAGE:3968862), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 54719. Forward Primer - name:054719_F_IRAV47_a12_Car11, sequence:AGAAGGGGTGTGCATTGG; Reverse Primer - name:054719_R_SP6_IRAV47_a12_Car11, sequence:AAGCCGAAGGATTCTGGG. The reverse primer contains a 5' extension containing an SP6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using SP6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:15435 same embryo
 EMAGE:15439 same embryo
 EMAGE:15434 same embryo
 EMAGE:15437 same embryo
 EMAGE:15438 same embryo
 EurExpress:euxassay_010644 same experiment
 MGI:4823624 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS