Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:18300

Btbd11 BTB (POZ) domain containing 11 ( MGI:1921257)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:18300 EMAGE:18300 EMAGE:18300 EMAGE:18300 EMAGE:18300
"Pseudo-wholemount" of euxassay_012089. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_012089_01 euxassay_012089_02 euxassay_012089_03 euxassay_012089_04
EMAGE:18300 EMAGE:18300 EMAGE:18300 EMAGE:18300 EMAGE:18300
euxassay_012089_05 euxassay_012089_06 euxassay_012089_07 euxassay_012089_08 euxassay_012089_09
EMAGE:18300 EMAGE:18300 EMAGE:18300 EMAGE:18300 EMAGE:18300
euxassay_012089_10 euxassay_012089_11 euxassay_012089_12 euxassay_012089_13 euxassay_012089_14
EMAGE:18300 EMAGE:18300 EMAGE:18300 EMAGE:18300 EMAGE:18300
euxassay_012089_15 euxassay_012089_16 euxassay_012089_17 euxassay_012089_18 euxassay_012089_19
EMAGE:18300 EMAGE:18300 EMAGE:18300 EMAGE:18300 EMAGE:18300
euxassay_012089_20 euxassay_012089_21 euxassay_012089_22 euxassay_012089_23 euxassay_012089_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:18300Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
18300_wholemount_strong.wlz
18300_wholemount_moderate.wlz
18300_wholemount_weak.wlz
18300_wholemount_possible.wlz
18300_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:18300_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
thymus primordium
moderate moderate
regionalmoderate expression: see section 11 12 weak expression: see section 13 14 15
hypothalamus mantle layer
moderate moderate
regionalmoderate expression: see section 11 weak expression: see section 10 13 14
diencephalon lateral wall mantle layer
weak weak
regionalweak expression: see section 09 10 11 12 13
cerebral cortex mantle layer
strong strong
regionalstrong expression: see section 20 moderate expression: see section 01 02 03 04 19 21 22 weak expression: see section 23
cerebral cortex marginal layer
strong strong
regionalstrong expression: see section 05 06 20 moderate expression: see section 01 02 03 04 07 15 16 17 18 19 21 22 weak expression: see section 08 09 14
medulla oblongata alar plate marginal layer
strong strong
regionalstrong expression: see section 05 06 07 08 16 17 18 moderate expression: see section 15
rest of cerebellum marginal layer
strong strong
regionalstrong expression: see section 02 03 04 05 06 07 08 09 10 11 13 14 15 16 17 18 19 20 21 moderate expression: see section 12
pons mantle layer
moderate moderate
regionalmoderate expression: see section 07 15 weak expression: see section 05 06 08 09 12 16 17 18
glossopharyngeal ix ganglion
moderate moderate
single cellmoderate expression: see section 06 07 18
trigeminal v ganglion
strong strong
single cellstrong expression: see section 02 03 moderate expression: see section 04 05 06 07 16 17 18 19 20 21
dorsal root ganglion
weak weak
single cellweak expression: see section 07 08 14 15 16
renal cortex
moderate moderate
regionalmoderate expression: see section 07 08 09 10 16 17 18 19
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T30711
Entity Detected:Btbd11, BTB (POZ) domain containing 11 ( MGI:1921257)
Sequence:sense strand is shown

>T30711
CGGCGTACTGTGAAGGCTACTTTCTTAAAAATATGATGGTCCTTATTGAAAACGAAGCGTTCAAGCAGCT
CCTGTACGACAAAAATGGCGAAGGGGCGGGCCAGGATGTGCTTCAGGACCTACAGAGGACGTTGGCCATT
AGGATTCAGTCTATCCACCTGTCGTCTTCCAAGGGTTCCGTGGTATGAGACGCCCCACGAGGCAATGGTC
CCCAGGAGCAAGGTTTCTGGCTCCCTTCTGCATTGGCACCACAAAAACACAAAAATTGTTCCTGGTGTCT
GTCTGTCTGTACTGGGCCAAGGAGCTGCCTCCACTGCCTCAGCTACTCTCCGGTCAGTGAACTTGGCTTC
CGTGTGCTCCTGAGCGAAGAACCGTCCACGCGTCTGCAGGTTAGATTGTAGCAGAGGCCAGAACCTGCAG
GCCAACTCACAGCAACCAAGCCCCCTCCAGTGCCCCGGAGCCATGGGCACCTGCTGCCAAGGACCATGAT
CTAGCAGACGGACCAAGGCTTAGAGATCTCTGCTTCCTGGTTGACTGATGAAAACCTCAGTAGTATGACC
TTGAAAAGCATCACATCACCCACGAATGACCTTGGAGGCTGTACTTGCCCAGGCATCAGCCCTGGTGGCT
AGTTGTTGATGCCATTGCCCGGCATGAGGAAGTCACATGGCCAATTTTTAGGGGTGGGAACTTTTTAAAA
AAAATGTTCATGTCTAGCAAACACAGAGCAGTCTCGTAGTTTCGAATATATTTCTAAAAGCTTAACAGTT
CATTTTCGACTGAATTGTGTTTAGGGAATCTGTGTTTGGGGTTCTTTTCATTTTTTTTTAAGATAGTGAG
TTGCAGGTCCGTGCCGTGTAAA
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from the plasmid IMAGE:6812291), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 60397. Forward Primer - name:060397_F_IRAV119_d05_Btbd11, sequence:CGGCGTACTGTGAAGGCT; Reverse Primer - name:060397_R_SP6_IRAV119_d05_Btbd11, sequence:GTTTACACGGCACGGACC. The reverse primer contains a 5' extension containing an SP6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using SP6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:18303 same embryo
 EMAGE:18299 same embryo
 EMAGE:18302 same embryo
 EMAGE:18301 same embryo
 EMAGE:18304 same embryo
 EurExpress:euxassay_012089 same experiment
 MGI:4823513 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS