Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:18643

Csrp2 cysteine and glycine-rich protein 2 ( MGI:1202907)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:18643 EMAGE:18643 EMAGE:18643 EMAGE:18643 EMAGE:18643
"Pseudo-wholemount" of euxassay_016538. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_016538_01 euxassay_016538_02 euxassay_016538_03 euxassay_016538_04
EMAGE:18643 EMAGE:18643 EMAGE:18643 EMAGE:18643 EMAGE:18643
euxassay_016538_05 euxassay_016538_06 euxassay_016538_07 euxassay_016538_08 euxassay_016538_09
EMAGE:18643 EMAGE:18643 EMAGE:18643 EMAGE:18643 EMAGE:18643
euxassay_016538_10 euxassay_016538_11 euxassay_016538_12 euxassay_016538_13 euxassay_016538_14
EMAGE:18643 EMAGE:18643 EMAGE:18643 EMAGE:18643 EMAGE:18643
euxassay_016538_15 euxassay_016538_16 euxassay_016538_17 euxassay_016538_18 euxassay_016538_19
EMAGE:18643 EMAGE:18643 EMAGE:18643 EMAGE:18643
euxassay_016538_20 euxassay_016538_21 euxassay_016538_22 euxassay_016538_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:18643Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
18643_wholemount_strong.wlz
18643_wholemount_moderate.wlz
18643_wholemount_weak.wlz
18643_wholemount_possible.wlz
18643_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:18643_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
pectoral girdle and thoracic body wall muscle
moderate moderate
regionalmoderate expression: see section 08 09 10 11 12 13 14 15
pancreas
weak weak
regionalweak expression: see section 07 08 09
telencephalon mantle layer
weak weak
regionalweak expression: see section 05 06 07 08 09 10 11 15 17 18 19
dorsal grey horn
weak weak
regionalweak expression: see section 08 10 11 12
intermediate grey horn
weak weak
regionalweak expression: see section 06 07
neural retina
weak weak
regionalweak expression: see section 01 02 03 21 22 23
aorta
moderate moderate
regionalmoderate expression: see section 09 10 weak expression: see section 08
stomach
weak weak
regionalweak expression: see section 04 05 06 07
hindgut
weak weak
regionalweak expression: see section 10 11
midgut
moderate moderate
regionalmoderate expression: see section 09 weak expression: see section 10 11 12 13 14 15 16 17
bladder
moderate moderate
regionalmoderate expression: see section 09 10 weak expression: see section 11 12
temporal bone
weak weak
regionalweak expression: see section 03
vault of skull
weak weak
regionalweak expression: see section 01 02 03 21 22 23
orbito-sphenoid
weak weak
regionalweak expression: see section 01 02 03 04 05 06 07 08 09 12 14 15 16 17 18 19 20 21 22 23
viscerocranium
weak weak
regionalExpression in the turbinate bone.
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T38966
Entity Detected:Csrp2, cysteine and glycine-rich protein 2 ( MGI:1202907)
Sequence:sense strand is shown

>T38966
ATGGAGGAGCTGAGAAGTGTTCCAGGTGTGGGGATTCCGTGTATGCTGCGGAGAAGATCATTGGAGCTGG
GAAGCCCTGGCACAAAAACTGTTTCCGGTGTGCCAAGTGTGGGAAGAGTCTGGAGTCTACAACTCTGACT
GAGAAAGAAGGCGAAATCTACTGTAAAGGGTGCTACGCAAAGAACTTTGGGCCCAAGGGATTTGGCTATG
GTCAAGGGGCAGGGGCCCTTGTTCATGCTCAGTAATGGTGTGGACCCAGTAAGCACGACAGAGAATCTCC
ATTACCAAACTGCAGATGGCGT
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 269722. Forward Primer - name:269722_F_cDNA_Csrp2, sequence:ATGGAGGAGCTGAGAAGTGTTC; Reverse Primer - name:269722_N_SP6_cDNA_Csrp2, sequence:ACGCCATCTGCAGTTTGGTAA. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:18646 same embryo
 EMAGE:18641 same embryo
 EMAGE:18645 same embryo
 EMAGE:18644 same embryo
 EMAGE:18642 same embryo
 EurExpress:euxassay_016538 same experiment
 MGI:4824089 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS