Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:19291

Erp44 endoplasmic reticulum protein 44 ( MGI:1923549)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:19291 EMAGE:19291 EMAGE:19291 EMAGE:19291 EMAGE:19291
"Pseudo-wholemount" of euxassay_001975. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_001975_01 euxassay_001975_02 euxassay_001975_03 euxassay_001975_04
EMAGE:19291 EMAGE:19291 EMAGE:19291 EMAGE:19291 EMAGE:19291
euxassay_001975_05 euxassay_001975_06 euxassay_001975_07 euxassay_001975_08 euxassay_001975_09
EMAGE:19291 EMAGE:19291 EMAGE:19291 EMAGE:19291 EMAGE:19291
euxassay_001975_10 euxassay_001975_11 euxassay_001975_12 euxassay_001975_13 euxassay_001975_14
EMAGE:19291 EMAGE:19291 EMAGE:19291 EMAGE:19291 EMAGE:19291
euxassay_001975_15 euxassay_001975_16 euxassay_001975_17 euxassay_001975_18 euxassay_001975_19
EMAGE:19291 EMAGE:19291 EMAGE:19291 EMAGE:19291 EMAGE:19291
euxassay_001975_20 euxassay_001975_21 euxassay_001975_22 euxassay_001975_23 euxassay_001975_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:19291Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
19291_wholemount_strong.wlz
19291_wholemount_moderate.wlz
19291_wholemount_weak.wlz
19291_wholemount_possible.wlz
19291_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:19291_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
meckel's cartilage
moderate moderate
regionalmoderate expression: see section 03 04 05 06 08 09 17 18 20 21 22 weak expression: see section 07
lower jaw incisor
moderate moderate
regionalmoderate expression: see section 10 11
lower jaw molar
moderate moderate
regionalmoderate expression: see section 06 08 17 18 19 weak expression: see section 07
upper jaw incisor
moderate moderate
regionalmoderate expression: see section 10 11
upper jaw molar
strong strong
regionalstrong expression: see section 09 moderate expression: see section 06 08 10 17 18 19 20 21 weak expression: see section 07
orbito-sphenoid
moderate moderate
regionalmoderate expression: see section 04 05 06 22 23 24 weak expression: see section 02 03
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T731
Entity Detected:Erp44, endoplasmic reticulum protein 44 ( MGI:1923549)
Sequence:sense strand is shown

>T731
TCTCGAGCCTGTTGGCTCTGGTTGNCTACTGGGTTCGCCGCTGGAGCTCCGGGTCGAGAGGACGAGGTGC
CGCTGCCGCCGGCCCCGGAGCCCAGCCCTTTTCTAGCCCGGTCCAGTCCCAGCCGCCACCTCCTGACCCC
GCCGTCGACCCCGTCGTTACCATGAATCCTGCGGTCTTCCTGTCTTTAGCAGACCTCAGATGCTCCTTGC
TGCTCCTGGTAACTTCAATTTTTACACCTATAACAGCTGAAATAGCAAGTCTTGATTCAGAGAATATAGA
TGAAATTTTAAATAATGCTGATGTTGCTTTAGTAAATTTTTATGCTGACTGGTGTCGTTTCAGCCAGATG
TTGCATCCAATTTTTGAGGAAGCATCTGATGTCATTAAGGAAGAATATCCAGATAAAAATCAAGTAGTGT
TTGCCAGAGTTGATTGTGATCAGCACTCTGATATAGCCCAGAGGTACAGGATAAGCAAATACCCAACCCT
GAAATTATTTCGTAATGGAATGATGATGAAGAGAGAATACAGGGGCCA
Notes:The probe template was PCR amplified from IMAGE:1890495 using vector specific primers. Forward Primer - name:T7-pME18S-FL3-fw, sequence:CGTAATACGACTCACTATAGGGCCTTCTGCTCTAAAAGCTGCG; Reverse Primer - name:T3-pME18S-FL3-rv, sequence:CAAATTAACCCTCACTAAAGGGCGACCTGCAGCTCGAGCAC. Anti-sense probe was then transcribed from the PCR amplified template using T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:1890495 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:19293 same embryo
 EMAGE:19294 same embryo
 EMAGE:19292 same embryo
 EMAGE:19290 same embryo
 EurExpress:euxassay_001975 same experiment
 MGI:4824619 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS