Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:19294

Chmp2a charged multivesicular body protein 2A ( MGI:1916203)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:19294 EMAGE:19294 EMAGE:19294 EMAGE:19294 EMAGE:19294
"Pseudo-wholemount" of euxassay_001955. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_001955_01 euxassay_001955_02 euxassay_001955_03 euxassay_001955_04
EMAGE:19294 EMAGE:19294 EMAGE:19294 EMAGE:19294 EMAGE:19294
euxassay_001955_05 euxassay_001955_06 euxassay_001955_07 euxassay_001955_08 euxassay_001955_09
EMAGE:19294 EMAGE:19294 EMAGE:19294 EMAGE:19294 EMAGE:19294
euxassay_001955_10 euxassay_001955_11 euxassay_001955_12 euxassay_001955_13 euxassay_001955_14
EMAGE:19294 EMAGE:19294 EMAGE:19294 EMAGE:19294 EMAGE:19294
euxassay_001955_15 euxassay_001955_16 euxassay_001955_17 euxassay_001955_18 euxassay_001955_19
EMAGE:19294 EMAGE:19294 EMAGE:19294 EMAGE:19294 EMAGE:19294
euxassay_001955_20 euxassay_001955_21 euxassay_001955_22 euxassay_001955_23 euxassay_001955_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:19294Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
19294_wholemount_strong.wlz
19294_wholemount_moderate.wlz
19294_wholemount_weak.wlz
19294_wholemount_possible.wlz
19294_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:19294_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
thymus primordium
strong strong
homogeneousstrong expression: see section 09 10 11 12 13
pancreas
moderate moderate
regionalmoderate expression: see section 07 08 09 10 14 15
brain
moderate moderate
homogeneousmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
vibrissa
strong strong
regionalstrong expression: see section 07 08 09 16 17 21 22
glossopharyngeal ix ganglion
strong strong
regionalstrong expression: see section 05 06 17
trigeminal v ganglion
strong strong
regionalstrong expression: see section 03 04 05 06 07 08 17 18 19 20 21 22
spinal cord
moderate moderate
homogeneousmoderate expression: see section 06 07 08 09 10 11 12 13
cervico-thoracic ganglion
strong strong
regionalstrong expression: see section 07 13
cervical ganglion
strong strong
regionalstrong expression: see section 07 15
thoracic ganglion
strong strong
regionalstrong expression: see section 10 11
dorsal root ganglion
strong strong
regionalstrong expression: see section 06 07 13 14 moderate expression: see section 08 09 10
nasal cavity olfactory epithelium
moderate moderate
regionalmoderate expression: see section 09 10 11 12 13 15 16 17 18 19 20
rectum
moderate moderate
regionalmoderate expression: see section 12 13
liver lobe
moderate moderate
regionalmoderate expression: see section 01 02 weak expression: see section 03 04 05 06 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
bladder
moderate moderate
regionalmoderate expression: see section 11 12 13
urethra of male
weak weak
regionalweak expression: see section 12 13
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T722
Entity Detected:Chmp2a, charged multivesicular body protein 2A ( MGI:1916203)
Sequence:sense strand is shown

>T722
TCTCGAGNCTGTTGGCCTACTGGGCTTAATCNGGAAACGGCGGCCGCAGCAGGGGCTACCGAACCGAGGG
GTTGTCGTTGGTGGAGTCTCAAGGCTTCGGAGGGGTAGAGGCGTGACCCGGAAGCGGAAACCCATCGTTC
TCTCGGCTCCGCTAGTTCTGACGGTTGTCCCAGACCTGCTGGTGGAGTCTTACCACCATGGACCTGTTGT
TTGGGCGCCGGAAGACGCCAGAGGAACTACTTCGGCAAAACCAGAGGGCCCTGAACCGAGCCATGAGAGA
ACTGGACAGGGAACGACAGAAACTAGAAACCCAGGAAAAGAAAATCATTGCGGACATCAAAAAGATGGCA
AAGCAAGGCCAGATGGATGCTGTTCGAATCATGGCAAAAGACCTGGTGCGTACCCGGAGATATGTACGCA
AGTTTGTGTTGATGCGGGCCAACATCCAAGCTGTGTCCCTCAAGATACAGACTCTAAAATCCAACAACTC
AATGGCACAAGCCATGAAGGGTGTTACTAAGGCCATGGGCACTATGAACAGACAGCTGAAATTACCC
Notes:The probe template was PCR amplified from IMAGE:1890185 using vector specific primers. Forward Primer - name:T7-pME18S-FL3-fw, sequence:CGTAATACGACTCACTATAGGGCCTTCTGCTCTAAAAGCTGCG; Reverse Primer - name:T3-pME18S-FL3-rv, sequence:CAAATTAACCCTCACTAAAGGGCGACCTGCAGCTCGAGCAC. Anti-sense probe was then transcribed from the PCR amplified template using T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:1890185 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:19293 same embryo
 EMAGE:19292 same embryo
 EMAGE:19290 same embryo
 EMAGE:19291 same embryo
 EurExpress:euxassay_001955 same experiment
 MGI:4823847 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS