Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:19739

Crmp1 collapsin response mediator protein 1 ( MGI:107793)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:19739 EMAGE:19739 EMAGE:19739 EMAGE:19739 EMAGE:19739
"Pseudo-wholemount" of euxassay_006182. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_006182_01 euxassay_006182_02 euxassay_006182_03 euxassay_006182_04
EMAGE:19739 EMAGE:19739 EMAGE:19739 EMAGE:19739 EMAGE:19739
euxassay_006182_05 euxassay_006182_06 euxassay_006182_07 euxassay_006182_08 euxassay_006182_09
EMAGE:19739 EMAGE:19739 EMAGE:19739 EMAGE:19739 EMAGE:19739
euxassay_006182_10 euxassay_006182_11 euxassay_006182_12 euxassay_006182_13 euxassay_006182_14
EMAGE:19739 EMAGE:19739 EMAGE:19739 EMAGE:19739 EMAGE:19739
euxassay_006182_15 euxassay_006182_16 euxassay_006182_17 euxassay_006182_18 euxassay_006182_19
EMAGE:19739 EMAGE:19739 EMAGE:19739
euxassay_006182_20 euxassay_006182_21 euxassay_006182_22

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:19739Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
19739_wholemount_strong.wlz
19739_wholemount_moderate.wlz
19739_wholemount_weak.wlz
19739_wholemount_possible.wlz
19739_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:19739_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
brain
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22
facial vii ganglion
strong strong
regionalstrong expression: see section 02 03 04 05 16 17 18
glossopharyngeal ix ganglion
strong strong
regionalstrong expression: see section 03 15
trigeminal v ganglion
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 15 16 17 18 19 20
vagus x ganglion
strong strong
regionalstrong expression: see section 04 13 14
vestibulocochlear viii ganglion
strong strong
regionalstrong expression: see section 03 04 05 13 14 15 16 17
trigeminal v nerve
strong strong
regionalstrong expression: see section 08 14 15 16
spinal cord
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13
cervico-thoracic ganglion
strong strong
regionalstrong expression: see section 05 06 08 10 11
cervical ganglion
strong strong
regionalstrong expression: see section 03 04 12
thoracic ganglion
strong strong
regionalstrong expression: see section 07 09 10 11 12
dorsal root ganglion
strong strong
regionalstrong expression: see section 02 03 04 05 06 07 08 09 10 11 12 13 14
neural retina
strong strong
regionalstrong expression: see section 01 02 03 22
tongue
strong strong
spottedstrong expression: see section 12 13
stomach
strong strong
spottedstrong expression: see section 01 02 03 04 05 06 07
rectum
strong strong
regionalstrong expression: see section 11 12
midgut
strong strong
regionalstrong expression: see section 08 09 10 11 12 13 14 15 16 17
genital tubercle of male
strong strong
regionalstrong expression: see section 09 13
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T549
Entity Detected:Crmp1, collapsin response mediator protein 1 ( MGI:107793)
Sequence:sense strand is shown

>T549
TCCTCGAGCCTGTTGGCCTACTGGAAGCCGGGCGGTGCAGGCAGCCGGAGCAGCGGCGGCGGGCCGAGCA
GCGGGGAGTGGGCAGCGGTGGGAGCCGAGCTTCTGTCCTTTCTTTCATCCCTCCCTGGCCCTTGTCGCCG
CTCTCACGAGTAGCGCCGCCGGGAGAGACCCGGGTAGAGCGCCAGGCAGACGTTAGTTCCAGCGGCCGGG
CGGAGGGCTCCAGAGGGGCCATGTCTCATCAGGGGAAGAAGAGCATCCCGCACATCACCAGTGACCGGCT
CCTCATCAGAGGTGGACGCATCATCAATGATGACCAGTCCTTCTACGCCGATGTCTACCTAGAAGATGGA
CTCATAAAACAAATAGGAGAGAACCTGATTGTTCCTGGTGGAGTGAAGACCATCGAGGCGAATGGCCGAA
TGGTCATTCCCGGTGGCATTGATGTCAACACTTACCTGCAGAAGCCCTCCCAGGGCATGACCTCGGCTGA
TGACTTCTTCCAGGGCACTAAAGCAGCGCTGGCAGGTGGAACCACGATGATCATTGACCAC
Notes:The probe template was PCR amplified from IMAGE:1499149 using vector specific primers. Forward Primer - name:T7-pME18S-FL3-fw, sequence:CGTAATACGACTCACTATAGGGCCTTCTGCTCTAAAAGCTGCG; Reverse Primer - name:T3-pME18S-FL3-rv, sequence:CAAATTAACCCTCACTAAAGGGCGACCTGCAGCTCGAGCAC. Anti-sense probe was then transcribed from the PCR amplified template using T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:1499149 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:19741 same embryo
 EMAGE:19743 same embryo
 EMAGE:19740 same embryo
 EMAGE:19742 same embryo
 EMAGE:19738 same embryo
 EurExpress:euxassay_006182 same experiment
 MGI:4824062 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS