Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:19769

Smyd2 SET and MYND domain containing 2 ( MGI:1915889)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:19769 EMAGE:19769 EMAGE:19769 EMAGE:19769 EMAGE:19769
"Pseudo-wholemount" of euxassay_006257. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_006257_01 euxassay_006257_02 euxassay_006257_03 euxassay_006257_04
EMAGE:19769 EMAGE:19769 EMAGE:19769 EMAGE:19769 EMAGE:19769
euxassay_006257_05 euxassay_006257_06 euxassay_006257_07 euxassay_006257_08 euxassay_006257_09
EMAGE:19769 EMAGE:19769 EMAGE:19769 EMAGE:19769 EMAGE:19769
euxassay_006257_10 euxassay_006257_11 euxassay_006257_12 euxassay_006257_13 euxassay_006257_14
EMAGE:19769 EMAGE:19769 EMAGE:19769 EMAGE:19769 EMAGE:19769
euxassay_006257_15 euxassay_006257_16 euxassay_006257_17 euxassay_006257_18 euxassay_006257_19
EMAGE:19769 EMAGE:19769 EMAGE:19769 EMAGE:19769
euxassay_006257_20 euxassay_006257_21 euxassay_006257_22 euxassay_006257_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:19769Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
19769_wholemount_strong.wlz
19769_wholemount_moderate.wlz
19769_wholemount_weak.wlz
19769_wholemount_possible.wlz
19769_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:19769_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
brain
strong strong
homogeneousstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23
facial vii ganglion
strong strong
regionalstrong expression: see section 03 04 05 06 17 18 19 20
glossopharyngeal ix ganglion
strong strong
regionalstrong expression: see section 05 06 16 17
trigeminal v ganglion
strong strong
regionalstrong expression: see section 03 04 05 06 07 08 16 17 18 19 20 21
vestibulocochlear viii ganglion
strong strong
regionalstrong expression: see section 05 06 16 17
trigeminal v nerve
strong strong
regionalstrong expression: see section 09 16
spinal cord
strong strong
homogeneousstrong expression: see section 05 06 07 08 09 10 11 12
cervico-thoracic ganglion
strong strong
regionalstrong expression: see section 07 12 13
cervical ganglion
strong strong
regionalstrong expression: see section 07 15
thoracic ganglion
strong strong
regionalstrong expression: see section 07 08 09 10
dorsal root ganglion
strong strong
regionalstrong expression: see section 05 06 07 08 09 11 12 13 14 15
not examined not examined
regionalnot examined expression: see section 01 02 03 04 22 23
retina
moderate moderate
regionalmoderate expression: see section 01 02 03 04 22 23
nasal cavity olfactory epithelium
strong strong
regionalstrong expression: see section 08 09 10 11 12 14 15 16 17 18
nasal cavity respiratory epithelium
strong strong
regionalstrong expression: see section 13
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T2390
Entity Detected:Smyd2, SET and MYND domain containing 2 ( MGI:1915889)
Sequence:sense strand is shown

>T2390
TGGCCTCGAGGCCAGATTCGGCACGAGGATNTGGACAGCTAGACAACGAGAAGAAAGATCTCATCCAGAG
TGACATCGCCGCTCTCCACCAGTTCTACTCCAAGTACCTGGAATTCCCTGACCACAGCAGTCTCGTGGTG
CTCTTCGCCCAGGTGAACTGTAATGGCTTCACTATTGAAGATGAAGAGCTCTCCCATTTGGGATCGGCGA
TATTCCCTGATGTTGCATTGATGAATCACAGCTGCTGCCCGAATGTCATTGTGACCTACAAAGGGACCCT
GGCAGAAGTCAGAGCTGTACAGGAGATCCACCCAGGAGACGAGGTGTTCACCAGCTACATCGACCTGCTA
TATCCAACAGAAGACAGGAACGACCGGCTAAGAGACTCCTATTTCTTTACCTGTGAGTGCCGGGAGTGTA
CAACCAAGGATAAGGACAAAGCCAAGGTGGAAGTCCGAAAGCTCAGCAGCCCGCCACAGGCAGAAGCCAT
CCGAGACATGGTCAGATACGCACGTAATGTCATCGAGGAGTTCCGGAGGGCC
Notes:The probe template was PCR amplified from IMAGE:1195355 using vector specific primers. Forward Primer - name:RZPD M13 forward, sequence:GCTATTACGCCAGCTGGCGAAAGGGGGATGTG; Reverse Primer - name:RZPD M13 reverse, sequence:CCCCAGGCTTTACACTTTATGCTTCCGGCTCG. Anti-sense probe was then transcribed from the PCR amplified template using T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:1195355 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:19771 same embryo
 EMAGE:19767 same embryo
 EMAGE:19766 same embryo
 EMAGE:19768 same embryo
 EMAGE:19770 same embryo
 EurExpress:euxassay_006257 same experiment
 MGI:4828339 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS