Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:20437

Hus1 Hus1 homolog (S. pombe) ( MGI:1277962)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:20437 EMAGE:20437 EMAGE:20437 EMAGE:20437 EMAGE:20437
"Pseudo-wholemount" of euxassay_012664. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_012664_01 euxassay_012664_02 euxassay_012664_03 euxassay_012664_04
EMAGE:20437 EMAGE:20437 EMAGE:20437 EMAGE:20437 EMAGE:20437
euxassay_012664_05 euxassay_012664_06 euxassay_012664_07 euxassay_012664_08 euxassay_012664_09
EMAGE:20437 EMAGE:20437 EMAGE:20437 EMAGE:20437 EMAGE:20437
euxassay_012664_10 euxassay_012664_11 euxassay_012664_12 euxassay_012664_13 euxassay_012664_14
EMAGE:20437 EMAGE:20437 EMAGE:20437 EMAGE:20437 EMAGE:20437
euxassay_012664_15 euxassay_012664_16 euxassay_012664_17 euxassay_012664_18 euxassay_012664_19
EMAGE:20437 EMAGE:20437
euxassay_012664_20 euxassay_012664_21

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:20437Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
20437_wholemount_strong.wlz
20437_wholemount_moderate.wlz
20437_wholemount_weak.wlz
20437_wholemount_possible.wlz
20437_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:20437_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
submandibular gland primordium
weak weak
regionalweak expression: see section 05 06 07 08 14 15 16
hypothalamus ventricular layer
weak weak
homogeneousweak expression: see section 09 10 11
diencephalon lateral wall ventricular layer
weak weak
homogeneousweak expression: see section 09 10 11
lateral ventricle choroid plexus
weak weak
regionalweak expression: see section 15 16 17
olfactory cortex ventricular layer
weak weak
homogeneousweak expression: see section 09 13 14 15
telencephalon ventricular layer
weak weak
homogeneousweak expression: see section 02 03 04 05 09 10 12 13 14 15 16 17 18 19 20 21
metencephalon part of 4th ventricle choroid plexus
weak weak
regionalweak expression: see section 04 05 15 16 17 18
midbrain ventricular layer
weak weak
regionalweak expression: see section 05 06 07 08 09 10 11 12 13
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T31937
Entity Detected:Hus1, Hus1 homolog (S. pombe) ( MGI:1277962)
Sequence:sense strand is shown

>T31937
CCAAGATCGTGGACCTGGCTTGTCTGAATCATTTCACACGAGTCAGTAACATGATAGCCAAGCTTGCCAA
AACCTGCACCCTCCGCATCAGCCCGGAGAAGCTGAACTTCATCCTTTGCGACAAGCTGGCCAGTGGAGGC
GTGAGCATGTGGTGTGAGCTGGAGCAGGAGAACTTTTTTAGTGAATTTCAAATGGAAGGAGTCTCTGAAG
AAAACAACGAGATTTATTTAGAATTAACGTCGGAAAACTTATCTCGAGCCTTGAAAACTGCCCAGAACTC
CAGAGCCTTGAAAATCAAGCTGACTAACAAACACTTTCCCTGTCTTACCGTGTCTGTAGAGCTGCAGGTG
TCTTCATCGAGCAGCAGCAGAATCGTGGTGCATGATATCCCCATAAAGGTTCTTCCGAGAAGACTGTGGA
AGGACTTACAAGAACCCTCCATCCCAGACTGTGATGTCAGTATTTGCTTACCAGCCTTGAAGATGATGAA
GAGTGTTGTGGAAAAAATGAGAAACATCAGCAATCAGCTTGTGATTGAAGCAAACCTAAAGGGAGAATTA
AACCTAAAGATAGAAACTGAGTTAGTGTGTGTGACTACTCATTTTAAGGATCTTGAAAACCCTCTATTAC
CCTCTGACAGTGTCTCTCAAAACAGACACCCAGAAGACATGGCCAAGGTGCACATTGACATAAAGAAACT
CCTCCAGTTTCTTGCCGGACAGCAAGTGAC
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from the plasmid IMAGE:30249148), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 61356. Forward Primer - name:061356_F_IRAW6_d04_Hus1, sequence:CCAAGATCGTGGACCTGG; Reverse Primer - name:061356_R_SP6_IRAW6_d04_Hus1, sequence:AGTCACTTGCTGTCCGGC. The reverse primer contains a 5' extension containing an SP6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using SP6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:20435 same embryo
 EMAGE:20436 same embryo
 EMAGE:20439 same embryo
 EMAGE:20434 same embryo
 EMAGE:20438 same embryo
 EurExpress:euxassay_012664 same experiment
 MGI:4825487 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS