Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:21275

Ptgfr prostaglandin F receptor ( MGI:97796)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:21275 EMAGE:21275 EMAGE:21275 EMAGE:21275 EMAGE:21275
"Pseudo-wholemount" of euxassay_001989. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_001989_01 euxassay_001989_02 euxassay_001989_03 euxassay_001989_04
EMAGE:21275 EMAGE:21275 EMAGE:21275 EMAGE:21275 EMAGE:21275
euxassay_001989_05 euxassay_001989_06 euxassay_001989_07 euxassay_001989_08 euxassay_001989_09
EMAGE:21275 EMAGE:21275 EMAGE:21275 EMAGE:21275 EMAGE:21275
euxassay_001989_10 euxassay_001989_11 euxassay_001989_12 euxassay_001989_13 euxassay_001989_14
EMAGE:21275 EMAGE:21275 EMAGE:21275 EMAGE:21275 EMAGE:21275
euxassay_001989_15 euxassay_001989_16 euxassay_001989_17 euxassay_001989_18 euxassay_001989_19
EMAGE:21275 EMAGE:21275 EMAGE:21275 EMAGE:21275
euxassay_001989_20 euxassay_001989_21 euxassay_001989_22 euxassay_001989_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:21275Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
21275_wholemount_strong.wlz
21275_wholemount_moderate.wlz
21275_wholemount_weak.wlz
21275_wholemount_possible.wlz
21275_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:21275_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
nose
strong strong
regionalstrong expression: see section 0 1 2 3 4 5 6 7 8 9 0
meckel's cartilage
strong strong
regionalstrong expression: see section 3 4 5 6 7 8 9 0 1 2 6 7 8 9 0 1 2
lower jaw incisor
strong strong
regionalstrong expression: see section 1 3 4 6 7 8 9
lower jaw molar
strong strong
regionalstrong expression: see section 8 9 0 1 8 9 0 1 2
upper jaw incisor
strong strong
regionalstrong expression: see section 1 3 4 5 6 7 8 9
upper jaw molar
strong strong
regionalstrong expression: see section 8 9 0 1 8 9 0 1 2
orbito-sphenoid
strong strong
regionalstrong expression: see section 4 5 6 7 8 6 0 1 2 moderate expression: see section 3
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T1152
Entity Detected:Ptgfr, prostaglandin F receptor ( MGI:97796)
Sequence:sense strand is shown

>T1152
CCTCNAGNCTGTTGGCCTACTGGAGCGCTCTTCTGCTCCGGACACAACCACTCAGTGGCTCAGGATGCCG
AGATGTCTGCACTCCGAGACTGCACAGTTGTGACAGAGAGATGACTTGAGGGGACAGCTTTTACCTCCAC
AACAATGTCTATGAACAGTTCCAAGCAGCCAGTGTCTCCTGCAGCTGGACTCATCGCAAACACAACCTGC
CAGACGGAGAACCGGCTTTCAGTATTTTTTTCTATCATCTTCATGACAGTGGGGATCTTATCGAACAGCC
TGGCCATCGCCATTCTCATGAAGGCCTACCAGAGATTTAGACAGAAGTCAAAGGCTTCCTTCCTGCTTTT
GGCTAGTGGCCTGGTGATCACAGACTTCTTTGGCCACCTTATCAACGGAGGCATAGCTGTCTTTGTATAT
GCTTCTGATAAAGACTGGATCCGCTTTGATCAGTCAAACATCCTGTGCAGTATTTTTGGAATCTCCATGG
TCTTTTCTGGCTTGTGCCCACTTTTTCTAGGCAGTGCGATGGCCATCGAGAGGTGTATAGGAGTCACCAA
TCCTATATTTCACTC
Notes:The probe template was PCR amplified from IMAGE:2136479 using vector specific primers. Forward Primer - name:T7-pME18S-FL3-fw, sequence:CGTAATACGACTCACTATAGGGCCTTCTGCTCTAAAAGCTGCG; Reverse Primer - name:T3-pME18S-FL3-rv, sequence:CAAATTAACCCTCACTAAAGGGCGACCTGCAGCTCGAGCAC. Anti-sense probe was then transcribed from the PCR amplified template using T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:2136479 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_001989 same experiment
 EMAGE:21276 same embryo
 EMAGE:21277 same embryo
 EMAGE:21278 same embryo
 EMAGE:21279 same embryo
 EMAGE:21280 same embryo
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS