Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:21278

Atp6v1b2 ATPase, H+ transporting, lysosomal V1 subunit B2 ( MGI:109618)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:21278 EMAGE:21278 EMAGE:21278 EMAGE:21278 EMAGE:21278
"Pseudo-wholemount" of euxassay_009121. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_009121_01 euxassay_009121_02 euxassay_009121_03 euxassay_009121_04
EMAGE:21278 EMAGE:21278 EMAGE:21278 EMAGE:21278 EMAGE:21278
euxassay_009121_05 euxassay_009121_06 euxassay_009121_07 euxassay_009121_08 euxassay_009121_09
EMAGE:21278 EMAGE:21278 EMAGE:21278 EMAGE:21278 EMAGE:21278
euxassay_009121_10 euxassay_009121_11 euxassay_009121_12 euxassay_009121_13 euxassay_009121_14
EMAGE:21278 EMAGE:21278 EMAGE:21278 EMAGE:21278 EMAGE:21278
euxassay_009121_15 euxassay_009121_16 euxassay_009121_17 euxassay_009121_18 euxassay_009121_19
EMAGE:21278 EMAGE:21278 EMAGE:21278 EMAGE:21278 EMAGE:21278
euxassay_009121_20 euxassay_009121_21 euxassay_009121_22 euxassay_009121_23 euxassay_009121_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:21278Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
21278_wholemount_strong.wlz
21278_wholemount_moderate.wlz
21278_wholemount_weak.wlz
21278_wholemount_possible.wlz
21278_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:21278_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
brain
strong strong
regionalstrong expression: see section 1 2 3 4 5 6 7 8 9 0 1 2 3 4 5 6 7 8 9 0 1 2 3 4
facial vii ganglion
strong strong
regionalstrong expression: see section 4 5 6 7 8 9 0
glossopharyngeal ix ganglion
strong strong
regionalstrong expression: see section 6 7 7
trigeminal v ganglion
strong strong
regionalstrong expression: see section 3 4 5 6 7 8 9 6 7 8 9 0 1 2
vagus x ganglion
strong strong
regionalstrong expression: see section 7 7
vestibulocochlear viii ganglion
strong strong
regionalstrong expression: see section 6 7 8 6 7
trigeminal v nerve
strong strong
regionalstrong expression: see section 0 7
spinal cord
strong strong
regionalstrong expression: see section 7 8 9 0 1 2 3 4 5
cervico-thoracic ganglion
strong strong
regionalstrong expression: see section 9 2 3 4 5
cervical ganglion
strong strong
regionalstrong expression: see section 8 9 5 6 7
thoracic ganglion
strong strong
regionalstrong expression: see section 9 0 1 2 3
dorsal root ganglion
strong strong
regionalstrong expression: see section 6 7 8 9 0 1 2 3 4 5 6
neural retina
strong strong
regionalstrong expression: see section 3 4 5 6 2 3 4
naris
strong strong
regionalstrong expression: see section 4 5 7 8
nasal cavity olfactory epithelium
moderate moderate
regionalmoderate expression: see section 2 3 4 6 7 8 9
liver
strong strong
regionalstrong expression: see section 2 3 4 5 6 7 8 9 0 1 2 3 4 5 7 8 9 0 1 2 3 4 moderate expression: see section 6
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T1156
Entity Detected:Atp6v1b2, ATPase, H+ transporting, lysosomal V1 subunit B2 ( MGI:109618)
Sequence:sense strand is shown

>T1156
CCTCGAGNCTGTTGGCCTACTGGAGTCGGGACGGAGGAGACAAGATGGCGTTGCGAGCGATGCGGGGAAT
CGTGAACGGGGCCGCACCCGAACTGCCCGTGCCCACCGGTGGGCCGATGGCCGGAGCTCGGGAGCAGGCG
CTGGCGGTGAGCCGGAACTACCTATCCCAGCCTCGTCTCACCTACAAGACTGTCTCTGGGGTGAATGGTC
CACTAGTGATCCTAGATCATGTGAAGTTTCCCAGATACGCTGAGATTGTCCACTTGACATTACCAGATGG
CACAAAGAGAAGTGGGCAAGTCCTAGAAGTTAGTGGCTCCAAAGCAGTGGTTCAGGTATTTGAAGGGACA
TCTGGTATAGACGCCAAGAAAACATCCTGTGAGTTTACTGGAGATATTCTCCGAACACCAGTGTCTGAGG
ATATGCTTGGTCGAGTATTCATCGGATCAGGAAAACCCATTGACCGAGGCCCTGTGGTGCTGGCTGAAGA
CTTCCTTGACATCATGGGTCAGCCAATCAACCCTCAGTGTCGGATCTATCCAGAAGAGATGATTCAGACG
GGCATTT
Notes:The probe template was PCR amplified from IMAGE:2136695 using vector specific primers. Forward Primer - name:T7-pME18S-FL3-fw, sequence:CGTAATACGACTCACTATAGGGCCTTCTGCTCTAAAAGCTGCG; Reverse Primer - name:T3-pME18S-FL3-rv, sequence:CAAATTAACCCTCACTAAAGGGCGACCTGCAGCTCGAGCAC. Anti-sense probe was then transcribed from the PCR amplified template using T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:2136695 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_009121 same experiment
 EMAGE:21275 same embryo
 EMAGE:21276 same embryo
 EMAGE:21277 same embryo
 EMAGE:21279 same embryo
 EMAGE:21280 same embryo
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS