Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:21344

Gpx7 glutathione peroxidase 7 ( MGI:1914555)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:21344 EMAGE:21344 EMAGE:21344 EMAGE:21344 EMAGE:21344
"Pseudo-wholemount" of euxassay_000006. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_000006_01 euxassay_000006_02 euxassay_000006_03 euxassay_000006_04
EMAGE:21344 EMAGE:21344 EMAGE:21344 EMAGE:21344 EMAGE:21344
euxassay_000006_05 euxassay_000006_06 euxassay_000006_07 euxassay_000006_08 euxassay_000006_09
EMAGE:21344 EMAGE:21344 EMAGE:21344 EMAGE:21344 EMAGE:21344
euxassay_000006_10 euxassay_000006_11 euxassay_000006_12 euxassay_000006_13 euxassay_000006_14
EMAGE:21344 EMAGE:21344 EMAGE:21344 EMAGE:21344 EMAGE:21344
euxassay_000006_15 euxassay_000006_16 euxassay_000006_17 euxassay_000006_18 euxassay_000006_19
EMAGE:21344 EMAGE:21344 EMAGE:21344 EMAGE:21344 EMAGE:21344
euxassay_000006_20 euxassay_000006_21 euxassay_000006_22 euxassay_000006_23 euxassay_000006_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:21344Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
21344_wholemount_strong.wlz
21344_wholemount_moderate.wlz
21344_wholemount_weak.wlz
21344_wholemount_possible.wlz
21344_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:21344_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
medulla oblongata part of 4th ventricle choroid plexus
strong strong
homogeneousstrong expression: see section 6 7 moderate expression: see section 8
rib
strong strong
regionalstrong expression: see section 7 1 moderate expression: see section 0 2 8 0 3 4 weak expression: see section 9 3
cervical intervertebral disc
strong strong
homogeneousstrong expression: see section 4 5 6 7 8 9 1 moderate expression: see section 0 2
lumbar intervertebral disc
strong strong
homogeneousstrong expression: see section 6 7
thoracic intervertebral disc
strong strong
homogeneousstrong expression: see section 6 7 8 9 1 moderate expression: see section 2 0 2
embryo
weak weak
regionalweak expression: see section 1
vertebral axis musculature
weak weak
regionalweak expression: see section 1
masseter
weak weak
regionalweak expression: see section 1
visceral organ system
strong strong
regionalstrong expression: see section 6
alimentary system
strong strong
regionalstrong expression: see section 4
gut
strong strong
regionalstrong expression: see section 6
foregut-midgut junction
strong strong
regionalstrong expression: see section 8 moderate expression: see section 8 weak expression: see section 0
foregut
strong strong
regionalstrong expression: see section 3 4 5 6 moderate expression: see section 8
not examined not examined
othernot examined expression: see section 2
skin
moderate moderate
regionalmoderate expression: see section 4
physiological umbilical hernia
strong strong
regionalstrong expression: see section 7 8 0 2 moderate expression: see section 6 9 3 4 5
physiological umbilical hernia dermis
strong strong
homogeneousstrong expression: see section 7 8 0 2 6 7 1 moderate expression: see section 6 9 1 3 4 5
physiological umbilical hernia epidermis
strong strong
otherstrong expression: see section 1 not examined expression: see section 6
dermis
strong strong
homogeneousstrong expression: see section 7 8 0 1 2 4 5 6 7 0 2 3 4 moderate expression: see section 2 3 4 5 6 9 3 9
epidermis
strong strong
homogeneousstrong expression: see section 7 8 0 1 2 4 5 6 7 0 2 3 4 moderate expression: see section 3 9 3 9
vibrissa
strong strong
regionalstrong expression: see section 3 7 1 2 3 4 moderate expression: see section 2 4 5 6 9 0
vibrissa dermal component
strong strong
regionalstrong expression: see section 3 7 1 2 3 4 moderate expression: see section 4 5 6 9
vibrissa epidermal component
strong strong
regionalstrong expression: see section 1 3 4 moderate expression: see section 2 0
pineal primordium
strong strong
homogeneousstrong expression: see section 2 5 6 moderate expression: see section 1 3 4
diencephalon dura mater
moderate moderate
regionalmoderate expression: see section 3
cerebral cortex
strong strong
homogeneousstrong expression: see section 9
choroid invagination
strong strong
homogeneousstrong expression: see section 1
lateral ventricle choroid plexus
strong strong
homogeneousstrong expression: see section 7 8 9 0 1 2 5 6 7 9 moderate expression: see section 3 4 8 0
telencephalon arachnoid mater
strong strong
homogeneousstrong expression: see section 2
telencephalon dura mater
strong strong
homogeneousstrong expression: see section 2 9
telencephalon pia mater
strong strong
homogeneousstrong expression: see section 9
hindbrain dura mater
moderate moderate
regionalmoderate expression: see section 3
metencephalon part of 4th ventricle choroid plexus
strong strong
homogeneousstrong expression: see section 1 2 5 6 7 moderate expression: see section 3 4 8 9
midbrain meninges
moderate moderate
gradedmoderate expression: see section 7 8
midbrain arachnoid mater
moderate moderate
gradedmoderate expression: see section 7
midbrain pia mater
moderate moderate
homogeneousmoderate expression: see section 8
nose
moderate moderate
regionalmoderate expression: see section 6 9 3 weak expression: see section 0
naris
strong strong
regionalstrong expression: see section 8 moderate expression: see section 4 1 4 4 weak expression: see section 3
anterior naris
moderate moderate
regionalmoderate expression: see section 4
anterior naris epithelium
moderate moderate
gradedmoderate expression: see section 4 weak expression: see section 3
external naris
strong strong
regionalstrong expression: see section 8 moderate expression: see section 2 4 6 4 4
external naris epithelium
moderate moderate
regionalmoderate expression: see section 4 6 3 4 4
posterior naris epithelium
moderate moderate
regionalmoderate expression: see section 2
nasal cavity
strong strong
regionalstrong expression: see section 8 moderate expression: see section 9 0 1 2 5 6 9 weak expression: see section 7 0
nasal cavity epithelium
strong strong
regionalstrong expression: see section 8 moderate expression: see section 7 9 0 1 2 5 6 9 weak expression: see section 0
nasal cavity olfactory epithelium
strong strong
regionalstrong expression: see section 8 moderate expression: see section 7 9 0 1 2 weak expression: see section 0
nasal cavity respiratory epithelium
moderate moderate
regionalmoderate expression: see section 2
foregut duodenum
strong strong
regionalstrong expression: see section 6 8
duodenum rostral part
strong strong
regionalstrong expression: see section 4 5
duodenum rostral part epithelium
strong strong
regionalstrong expression: see section 3 4 6
tongue intrinsic muscle
weak weak
regionalweak expression: see section 0
tongue intrinsic muscle transverse component
weak weak
regionalweak expression: see section 0
tongue intrinsic muscle vertical component
weak weak
regionalweak expression: see section 0
stomach
strong strong
regionalstrong expression: see section 6 7 moderate expression: see section 9
stomach fundus
strong strong
regionalstrong expression: see section 5 6 7
stomach fundus epithelium
strong strong
regionalstrong expression: see section 6 7
stomach pyloric region
strong strong
homogeneousstrong expression: see section 8
stomach pyloric region epithelium
strong strong
homogeneousstrong expression: see section 8
foregut-midgut junction duodenum
strong strong
homogeneousstrong expression: see section 8
foregut-midgut junction epithelium
strong strong
homogeneousstrong expression: see section 8
hindgut
moderate moderate
regionalmoderate expression: see section 8 9 0
midgut
moderate moderate
regionalmoderate expression: see section 9 0
rest of midgut
moderate moderate
regionalmoderate expression: see section 9
rest of midgut epithelium
moderate moderate
regionalmoderate expression: see section 9
lower jaw
strong strong
regionalstrong expression: see section 1 moderate expression: see section 8 2 weak expression: see section 9
lower lip
strong strong
regionalstrong expression: see section 1 moderate expression: see section 0 1 2 3 4 5 6 8 9 0 2 weak expression: see section 9
mandible
moderate moderate
regionalmoderate expression: see section 7
lower jaw mesenchyme
strong strong
regionalstrong expression: see section 1 moderate expression: see section 7 8 0 2 5 0 2
upper jaw
moderate moderate
regionalmoderate expression: see section 0 2
upper lip
strong strong
regionalstrong expression: see section 1 moderate expression: see section 8 0 1 2 3 4 5 6 8 9 0 2
upper jaw mesenchyme
strong strong
regionalstrong expression: see section 1 moderate expression: see section 8 0 2 5 8 9
upper jaw alveolar sulcus
moderate moderate
regionalmoderate expression: see section 6
palatal shelf
moderate moderate
regionalmoderate expression: see section 8
skeleton
moderate moderate
othermoderate expression: see section 0 not examined expression: see section 1
axial skeleton
strong strong
homogeneousstrong expression: see section 5 7 9 1 moderate expression: see section 0 3
axial skeleton cervical region
strong strong
homogeneousstrong expression: see section 4 7 1 moderate expression: see section 0 2
axial skeleton lumbar region
strong strong
homogeneousstrong expression: see section 7
nucleus pulposus
strong strong
homogeneousstrong expression: see section 4 6 8 9 moderate expression: see section 5
sacral vertebral cartilage condensation
strong strong
homogeneousstrong expression: see section 9 moderate expression: see section 0
axial skeleton thoracic region
strong strong
regionalstrong expression: see section 1 7 1 moderate expression: see section 0 2 0 2 weak expression: see section 3
temporal bone
weak weak
regionalweak expression: see section 4
pectoral girdle and thoracic body wall skeleton
moderate moderate
regionalmoderate expression: see section 3 weak expression: see section 9
clavicle
strong strong
regionalstrong expression: see section 1
scapula
strong strong
homogeneousstrong expression: see section 7
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T1768
Entity Detected:Gpx7, glutathione peroxidase 7 ( MGI:1914555)
Sequence:sense strand is shown

>T1768
TGGCCTCGAGCCAGATTCGGACGAGGCTCGGGAGTGAACCATGGTTGCAGCTGTGGCGACGGCGTGGCTG
CTCCTGTGGGCCGCGGCCTGCGCGCAATCCGAGCAGGACTTCTACGACTTCAAGGCGGTCAACATCCGGG
GCAAGCTGGTGTCGCTGGAGAAGTACCGTGGCTCGGTTTCCCTGGTGGTGAACGTAGCTAGCGAATGTGG
CTTCACAGACCAGAACTACCGAGCCTTGCAGCAGCTGCAGCGGGACCTGGGCCCCCATCATTTTAATGTG
CTTGCCTTCCCTTGCAACCAGTTTGGCCAACAGGAACCAGACACCAACAGGGAGATTGAGAACTTTGCCC
GCCGCACCTACAGTGTCTCTTTTCCCATGTTTAGCAAGATCGCAGTCACTGGCACTGGTGCCCACCCTGC
CTTCAAGTACCTAACCCAGACTTCTGGGAAGGAGCCCACCTGGAACTTCTGGAAGTACCTAGTGGACCCA
GACGGAAAGGTGGTGGGAGCATGGGACCCCACTGTGCCAGTGGCGGAGATCAAGCCCCGTATTACAGAGC
AGGTGATGA
Notes:The probe template was PCR amplified from IMAGE:484233 using vector specific primers. Forward Primer - name:RZPD M13 forward, sequence:GCTATTACGCCAGCTGGCGAAAGGGGGATGTG; Reverse Primer - name:RZPD M13 reverse, sequence:CCCCAGGCTTTACACTTTATGCTTCCGGCTCG. Anti-sense probe was then transcribed from the PCR amplified template using T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:484233 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_000006 same experiment
 EMAGE:21345 same embryo
 EMAGE:21343 same embryo
 EMAGE:21346 same embryo
 EMAGE:21342 same embryo
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS