Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:21460

Clmn calmin ( MGI:2136957)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:21460 EMAGE:21460 EMAGE:21460 EMAGE:21460 EMAGE:21460
"Pseudo-wholemount" of euxassay_000901. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_000901_01 euxassay_000901_02 euxassay_000901_03 euxassay_000901_04
EMAGE:21460 EMAGE:21460 EMAGE:21460 EMAGE:21460 EMAGE:21460
euxassay_000901_05 euxassay_000901_06 euxassay_000901_07 euxassay_000901_08 euxassay_000901_09
EMAGE:21460 EMAGE:21460 EMAGE:21460 EMAGE:21460 EMAGE:21460
euxassay_000901_10 euxassay_000901_11 euxassay_000901_12 euxassay_000901_13 euxassay_000901_14
EMAGE:21460 EMAGE:21460 EMAGE:21460 EMAGE:21460 EMAGE:21460
euxassay_000901_15 euxassay_000901_16 euxassay_000901_17 euxassay_000901_18 euxassay_000901_19
EMAGE:21460 EMAGE:21460 EMAGE:21460 EMAGE:21460
euxassay_000901_20 euxassay_000901_21 euxassay_000901_22 euxassay_000901_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:21460Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
21460_wholemount_strong.wlz
21460_wholemount_moderate.wlz
21460_wholemount_weak.wlz
21460_wholemount_possible.wlz
21460_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:21460_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: three stars
Text Annotation:
StructureLevelPatternNotes
limb
moderate moderate
regionalmoderate expression: see section 3 4 5
hindlimb
moderate moderate
regionalmoderate expression: see section 6 1 2 3
foregut-midgut junction
strong strong
regionalstrong expression: see section 5
thyroid gland
strong strong
homogeneousstrong expression: see section 1 2 6 7
telencephalon
moderate moderate
homogeneousmoderate expression: see section 5 6 7 8 9 0 1 3 4 5 6 7 8 9 0 weak expression: see section 2
metencephalon
moderate moderate
homogeneousmoderate expression: see section 5 6 7 8 9 0 1 2 3 4 5 6 7 8 9 0 1 2
nose
moderate moderate
homogeneousmoderate expression: see section 8 9 0 1 2 4 5 6 7 8 9 0
nasal cavity olfactory epithelium
moderate moderate
homogeneousmoderate expression: see section 1 2 3 4 5 6 7 8 9 0
hindgut
strong strong
regionalstrong expression: see section 4
midgut
strong strong
regionalstrong expression: see section 2 3 4 moderate expression: see section 7 8 9
lower jaw mesenchyme
moderate moderate
regionalmoderate expression: see section 0 1 2 3 4 5 6 7
kidney calyx
moderate moderate
homogeneousmoderate expression: see section 3 0 1
kidney pelvis
moderate moderate
homogeneousmoderate expression: see section 3 0
testis
moderate moderate
homogeneousmoderate expression: see section 9 0 1 3 4 1 weak expression: see section 0
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T366
Entity Detected:Clmn, calmin ( MGI:2136957)
Sequence:sense strand is shown

>T366
CTAATGGCTCTGTTAGAAGTCCTCTCTGGGCGAAATCTGCTGCATGAATACAAATCCTCATCACATCGTA
TTTTTCGGTTGAACAACATAGCGAAAGCACTCAAGTTTCTGGAAGATAGCAATGTCAAGCTGGTTAGCAT
CGATGCAGCGGAAATAGCGGACGGCAACCCCTCGCTGGTTCTCGGGCTGATATGGAACATCATTCTCTTC
TTCCAGATAAAGGAGCTCACGGGCAACCTCAGCAGGAGTTCTCCATCTTCCAGCTTGTCACCGGGCTCTG
GGGGCACCGACTCCGACTCTTCCTACCCACCCACCCCCACCACCGAGAGGAGTGTGGCAGTGGCAGTGAA
AGACCAGAGGAAGGCCATCAAGACCCTGCTGTCATGGGTGCAGAGGAAAACCAGGAAGTATGGTGTGGCA
GTCCAAGACTTTGCAGGCAGCTGGAGGAGTGGCCTGGCTTTCCTGGCTGTCATCAAAGCTATTGA
Notes:The probe template was PCR amplified from IMAGE:3155880 using vector specific primers. Forward Primer - name:RZPD T7, sequence:TAATACGACTCACTATAGGG; Reverse Primer - name:RZPD sp6, sequence:ATTTAGGTGACACTATAG. Anti-sense probe was then transcribed from the PCR amplified template using T7 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:3155880 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_000901 same experiment
 EMAGE:21464 same embryo
 EMAGE:21459 same embryo
 EMAGE:21463 same embryo
 EMAGE:21461 same embryo
 EMAGE:21462 same embryo
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS