Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:31177

Dkk3 dickkopf homolog 3 (Xenopus laevis) ( MGI:1354952)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:31177 EMAGE:31177 EMAGE:31177 EMAGE:31177 EMAGE:31177
euxassay_010080_01 euxassay_010080_02 euxassay_010080_03 euxassay_010080_04 euxassay_010080_05
EMAGE:31177 EMAGE:31177 EMAGE:31177 EMAGE:31177 EMAGE:31177
euxassay_010080_06 euxassay_010080_07 euxassay_010080_08 euxassay_010080_09 euxassay_010080_10
EMAGE:31177 EMAGE:31177 EMAGE:31177 EMAGE:31177 EMAGE:31177
euxassay_010080_11 euxassay_010080_12 euxassay_010080_13 euxassay_010080_14 euxassay_010080_15
EMAGE:31177 EMAGE:31177 EMAGE:31177 EMAGE:31177 EMAGE:31177
euxassay_010080_16 euxassay_010080_17 euxassay_010080_18 euxassay_010080_19 euxassay_010080_20
EMAGE:31177 EMAGE:31177 EMAGE:31177 EMAGE:31177
euxassay_010080_21 euxassay_010080_22 euxassay_010080_23 euxassay_010080_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: one star
Expression Pattern Description
Text Annotation:
StructureLevelPatternNotes
neural retina
moderate moderate
regionalmoderate expression: see section 01 02 03 04 22 23 24
hindlimb digit 5 mesenchyme
moderate moderate
regionalmoderate expression: see section 09 22 23
hindlimb digit 1 mesenchyme
moderate moderate
regionalmoderate expression: see section 09 22 23 weak expression: see section 21
knee mesenchyme
moderate moderate
regionalmoderate expression: see section 01 02 03
humerus
moderate moderate
regionalmoderate expression: see section 02 03 04 05 19 20 21 22 24
hindlimb digit 4 mesenchyme
moderate moderate
regionalmoderate expression: see section 09 22 23 weak expression: see section 06 07 08 10
rib
weak weak
regionalweak expression: see section 01 02 03 04 05 06 07 08 09 10 13 14 15 16 17 18 19 20 21 22 23 24
pons ventricular layer
moderate moderate
regionalmoderate expression: see section 04 05 06 07 20 21 weak expression: see section 08 09 10 12 13 14 15 16 17 18 19
axial skeleton
weak weak
regionalweak expression: see section 09 10 12 13 14
foot mesenchyme
moderate moderate
regionalmoderate expression: see section 23 24 weak expression: see section 06 07
hindlimb digit 2 mesenchyme
moderate moderate
regionalmoderate expression: see section 09 22 23 weak expression: see section 06 07 08 10 21
spinal cord ventricular layer
weak weak
regionalweak expression: see section 11 12 13 14
hindlimb digit 3 mesenchyme
moderate moderate
regionalmoderate expression: see section 09 22 23 weak expression: see section 06 07 08 10 21
aorta
moderate moderate
regionalmoderate expression: see section 12 weak expression: see section 09 10 11
femur
moderate moderate
regionalmoderate expression: see section 09 10 18 19
telencephalon ventricular layer
strong strong
regionalstrong expression: see section 06 07 08 09 10 11 15 16 17 18 20 21 moderate expression: see section 05 19 22 weak expression: see section 04
hypothalamus ventricular layer
strong strong
regionalstrong expression: see section 12 13 14
diencephalon lateral wall ventricular layer
strong strong
regionalstrong expression: see section 12 13 14
Annotation Validation: text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T32094
Entity Detected:Dkk3, dickkopf homolog 3 (Xenopus laevis) ( MGI:1354952)
Sequence:sense strand is shown

>T32094
TAAGGGCAGCGGTGAGTCGTCCCTCGCTGTTGCTAGAAACGCTGTCTTGTTCTTCATGGATGGAAGATTT
GTTTGAAGGGAGAGGATGGGAAGGGGTGAAGTCTGCTCATGATGGATTTGGGGGATACAGGGAGGAGGAT
GCCTGCCTTGCAGACGTGGACTTGGCAAAATGTAACCTTTGCTTTTGTCTTGCGCCGCTCCCATGGGCTG
AGGCAGTGGCTACACAAGAGCTATGCTGCTCTGTGGCCTCCCACATATTCATCCCTGTGTTTCAGCTCCT
ACCTCACTGTCAGCACAGCCCTTCATAGCCACGCCCCCTCTTGCTCACCACAGCCTAGGAGGGGACCAGA
GGGGACTTCTCTCAGAGCCCCATGCTCTCTCTCTCAACCCCATACCAGCCTCTGTGCCAGCGACAGTCCT
TCCAAATGGAGGGAGTGAAATCCTTTGGTTTTATTATTTTCTCCTTCAAGGCACGCCTGCCACTAAGGTC
AGGCTGACTTGCATGTCCCTCTAACGTTCGTAGCAGTGTGGTGGACACTGTCTTCCACCGACTGCTTCAA
TACCTCTGAAAGCCAGTGCTCGGAGTGCAGTTCGTGTAAATTAATTTGCAGGAAGTATACTTGGCTAATT
GTAGGGCTAGGATTGTGAATGAAATTTGCAAAGTCGCTTAGCAACAATGGAAAGCCTTTCTCAGTCACAC
CGAGAAGTCACAACCAAGCCAGGTTGTGTAGAGTACAGCTGTGACATACAGACAGAAGAAGGCTGGGCTG
GATGTCAGGCCTCAGATGACGGTTTCAGGTGCCA
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from the plasmid IMAGE:6493718), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 58102. Forward Primer - name:058102_F_IRAV91_a02_Dkk3, sequence:TAAGGGCAGCGGTGAGTC; Reverse Primer - name:058102_R_SP6_IRAV91_a02_Dkk3, sequence:CTGGCACCTGAAACCGT. The reverse primer contains a 5' extension containing an SP6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using SP6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_010080 same experiment
 EMAGE:29392 same embryo
 EMAGE:29370 same embryo
 EMAGE:31163 same embryo
 EMAGE:31056 same embryo
 EMAGE:29402 same embryo
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS