Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:31271

Arhgdig Rho GDP dissociation inhibitor (GDI) gamma ( MGI:108430)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:31271 EMAGE:31271 EMAGE:31271 EMAGE:31271 EMAGE:31271
euxassay_000468_01 euxassay_000468_02 euxassay_000468_03 euxassay_000468_04 euxassay_000468_05
EMAGE:31271 EMAGE:31271 EMAGE:31271 EMAGE:31271 EMAGE:31271
euxassay_000468_06 euxassay_000468_07 euxassay_000468_08 euxassay_000468_09 euxassay_000468_10
EMAGE:31271 EMAGE:31271 EMAGE:31271 EMAGE:31271 EMAGE:31271
euxassay_000468_11 euxassay_000468_12 euxassay_000468_13 euxassay_000468_14 euxassay_000468_15
EMAGE:31271 EMAGE:31271 EMAGE:31271 EMAGE:31271 EMAGE:31271
euxassay_000468_16 euxassay_000468_17 euxassay_000468_18 euxassay_000468_19 euxassay_000468_20
EMAGE:31271 EMAGE:31271 EMAGE:31271 EMAGE:31271
euxassay_000468_21 euxassay_000468_22 euxassay_000468_23 euxassay_000468_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: one star
Expression Pattern Description
Text Annotation:
StructureLevelPatternNotes
dorsal root ganglion
moderate moderate
regionalmoderate expression: see section 08 09 10 13 14 15 16 17 18 19 weak expression: see section 11
facial vii ganglion
strong strong
regionalstrong expression: see section 04 moderate expression: see section 21 22
medulla oblongata basal plate
moderate moderate
homogeneousmoderate expression: see section 09 10 17 18 weak expression: see section 07
vagus x ganglion
moderate moderate
regionalmoderate expression: see section 09 19
upper jaw molar
moderate moderate
regionalmoderate expression: see section 13 14 weak expression: see section 10 11
trigeminal v ganglion
strong strong
homogeneousstrong expression: see section 04 05 moderate expression: see section 03 06 07 08 09 17 18 19 20 21 22 23
nasal cavity olfactory epithelium
moderate moderate
regionalmoderate expression: see section 06 07 08 09 10 11 13 15 16 17 18
ventral grey horn
moderate moderate
regionalmoderate expression: see section 10 11 12 13 14 15 16 17
medulla oblongata basal plate ventricular layer
moderate moderate
regionalmoderate expression: see section 14 15 16
glossopharyngeal ix ganglion
moderate moderate
regionalmoderate expression: see section 07 08 20
Annotation Validation: text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T3821
Entity Detected:Arhgdig, Rho GDP dissociation inhibitor (GDI) gamma ( MGI:108430)
Sequence:sense strand is shown

>T3821
TGGCCTCGAGCCAGATTCGGACGAGGCAAATGTCTGCATCACACCTATCGTCGGGGACTGCGTGTGGACA
AGGCCATCTTCATGGTGGGAAGCTACGGCCCCAGAGCCCAGGAGTATGAATTTGTGACTTCAGTGGAGGA
AGCACCAAGAGGAGCATTGGCACGTGGCCTCTACGTGGTCAGGTCCCTCTTCACTGATGACGACAGGCTG
AACCACCTGTCCTGGGAGTGGCACCTCCATGTCTGCCAGGACTGGAAGGACTGAACCCCACTTGGGGTCT
GTATTCCCAATTTTCTTGTCAGTTGCAGAGACCTGCAAGCATTNCCTANACCTCCCAGTTGGTGACCA
Notes:The probe template was PCR amplified from IMAGE:407050 using vector specific primers. Forward Primer - name:RZPD M13 forward, sequence:GCTATTACGCCAGCTGGCGAAAGGGGGATGTG; Reverse Primer - name:RZPD M13 reverse, sequence:CCCCAGGCTTTACACTTTATGCTTCCGGCTCG. Anti-sense probe was then transcribed from the PCR amplified template usi. T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:407050 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_000468 same experiment
 EMAGE:30316 same embryo
 EMAGE:30289 same embryo
 EMAGE:31223 same embryo
 EMAGE:30286 same embryo
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS