Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:31281

1200013B08Rik ( MGI:1921381)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:31281 EMAGE:31281 EMAGE:31281 EMAGE:31281 EMAGE:31281
euxassay_008188_01 euxassay_008188_02 euxassay_008188_03 euxassay_008188_04 euxassay_008188_05
EMAGE:31281 EMAGE:31281 EMAGE:31281 EMAGE:31281 EMAGE:31281
euxassay_008188_06 euxassay_008188_07 euxassay_008188_08 euxassay_008188_09 euxassay_008188_10
EMAGE:31281 EMAGE:31281 EMAGE:31281 EMAGE:31281 EMAGE:31281
euxassay_008188_11 euxassay_008188_12 euxassay_008188_13 euxassay_008188_14 euxassay_008188_15
EMAGE:31281 EMAGE:31281 EMAGE:31281 EMAGE:31281 EMAGE:31281
euxassay_008188_16 euxassay_008188_17 euxassay_008188_18 euxassay_008188_19 euxassay_008188_20
EMAGE:31281 EMAGE:31281 EMAGE:31281 EMAGE:31281
euxassay_008188_21 euxassay_008188_22 euxassay_008188_23 euxassay_008188_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: one star
Expression Pattern Description
Text Annotation:
StructureLevelPatternNotes
thymus primordium
strong strong
homogeneousstrong expression: see section 11 12 13 14 15
heart ventricle
moderate moderate
spottedmoderate expression: see section 08 09 10 11 12 13 14 15 16 17
Annotation Validation: text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T229
Entity Detected:1200013B08Rik, ( MGI:1921381)
Sequence:sense strand is shown

>T229
AAGGGACCTAGCCATGCCATGTGATCACGGCCCCAAAAACCTTCTTACCCTCACACCACTGTCCCATTGC
TTCTAAGAAGGACGCCAAGCCACTGTCTCAAAGCACTCTTTAAGCCCTGGGGAAGCTTGCTCCTTCAAAG
GATCTCAGGTGGACATAAGTGAGTTTGGAATTCCTTAAATGAGGTTTGAAAGAACCTTCACACCCGTTCT
CCACTATCCTTCTCAACATTTTCGAGGTCTGACCACTAAGTCACAAGACTTGAACTATGTCTGTGCTTCT
TTTGACTTCATCCTGGTCGGGATTCGAATAGGCAGTTGTTGAGGGTCCCACCAGTTGACACTGTGTACCT
TTAACTATTTGCTCTCCCGCTGCCTGCTAGCCAGGACACCAGTGAGTAGGCTTCTTGAAGAGGCTGTAAG
GGCCTAGGGTTTCCAGTGAAATAGCGCTGCCTTCTCAGTCATCTCATACCTTTCTGTGTGACCCAAACT
Notes:The probe template was PCR amplified from IMAGE:2650417 using vector specific primers. Forward Primer - name:RZ. T7, sequence:TAATACGACTCACTATAGGG; Reverse Primer - name:RZPD sp6, sequence:ATTTAGGTGACACTATAG. Anti-sense probe was then transcribed from the PCR amplified template usi. T7 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:2650417 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:NMRI
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_008188 same experiment
 EMAGE:31291 same embryo
 EMAGE:31290 same embryo
 EMAGE:31699 same embryo
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS