Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:31515

Cd34 CD34 antigen ( MGI:88329)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:31515 EMAGE:31515 EMAGE:31515 EMAGE:31515 EMAGE:31515
euxassay_000612_01 euxassay_000612_02 euxassay_000612_03 euxassay_000612_04 euxassay_000612_05
EMAGE:31515 EMAGE:31515 EMAGE:31515 EMAGE:31515 EMAGE:31515
euxassay_000612_06 euxassay_000612_07 euxassay_000612_08 euxassay_000612_09 euxassay_000612_10
EMAGE:31515 EMAGE:31515 EMAGE:31515 EMAGE:31515 EMAGE:31515
euxassay_000612_11 euxassay_000612_12 euxassay_000612_13 euxassay_000612_14 euxassay_000612_15
EMAGE:31515 EMAGE:31515 EMAGE:31515 EMAGE:31515 EMAGE:31515
euxassay_000612_16 euxassay_000612_17 euxassay_000612_18 euxassay_000612_19 euxassay_000612_20
EMAGE:31515 EMAGE:31515 EMAGE:31515 EMAGE:31515
euxassay_000612_21 euxassay_000612_22 euxassay_000612_23 euxassay_000612_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: one star
Expression Pattern Description
Text Annotation:
StructureLevelPatternNotes
oral epithelium
moderate moderate
regionalmoderate expression: see section 01 02 06 07 08 09 14 16 21
foregut-midgut junction
moderate moderate
regionalmoderate expression: see section 03 05
kidney calyx
moderate moderate
regionalmoderate expression: see section 01 02 04 05 06 07 08 12
tongue
weak weak
regionalweak expression: see section 03 04 05 11 15 17 18
midgut loop epithelium
moderate moderate
regionalmoderate expression: see section 11 12 13 14 15 16 17 18 21 22
foot mesenchyme
moderate moderate
regionalmoderate expression: see section 09 10 16 19 20 21 22 23 24
foregut-midgut junction epithelium
moderate moderate
regionalmoderate expression: see section 11 15 17 18
testis
moderate moderate
regionalmoderate expression: see section 01 02 08 09 14 16 21
midgut
moderate moderate
regionalmoderate expression: see section 01 03 04 05 06 07 11
stomach fundus epithelium
moderate moderate
regionalmoderate expression: see section 01 04 14 16 19 21 22 23 24
pharyngo-tympanic tube
strong strong
regionalstrong expression: see section 10 19 20 22 23 24
hand mesenchyme
moderate moderate
regionalmoderate expression: see section 23 24
vertebral axis musculature
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
adrenal gland
weak weak
regionalweak expression: see section 04 05 06 07 08 12 13 14
hindgut
moderate moderate
regionalmoderate expression: see section 03 05
epidermis
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
rest of hindgut epithelium
moderate moderate
regionalmoderate expression: see section 13 15
lower jaw
moderate moderate
regionalmoderate expression: see section 01 02 04 05 06 07 08 09 10 12 13 14 16 18 19 20 21 22 23 24
lung
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 20 21
Annotation Validation: text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T383
Entity Detected:Cd34, CD34 antigen ( MGI:88329)
Sequence:sense strand is shown

>T383
GGAGAATGCAGGTCCACAGGGACACGCGCGCGGGGCTCCTGCTGCCATGGCGCTGGGTAGCTCTCTGCCT
GATGAGTCTGCTGCATCTAAATAACTTGACTTCTGCTACCACGGAGACTTCTACACAAGGAATATCCCCA
TCAGTTCCTACCAATGAGTCTGTTGAGGAAAATATCACATCTAGCATCCCTGGAAGTACCAGCCACTACT
TGATCTATCAGGACAGCAGTAAGACCACACCAGCCATCTCAGAGACTATGGTCAACTTTACAGTTACCTC
TGGGATCCCTTCAGGCTCTGGAACTCCACACACTTTTTCACAACCACAGACTTCCCCAACTGGCATACTG
CCTACTACTTCAGACAGTATTTCCACTTCAGAGATGACCTGGAAGTCCAGCCTGCCATCTATAAATGTTT
CTGATTATTCGCCTAATAATAGCAGCTTTGAGATGACATCACCCACCGAGCCATATGC
Notes:The probe template was PCR amplified from IMAGE:3156544 using vector specific primers. Forward Primer - name:RZ. T7, sequence:TAATACGACTCACTATAGGG; Reverse Primer - name:RZPD sp6, sequence:ATTTAGGTGACACTATAG. Anti-sense probe was then transcribed from the PCR amplified template usi. T7 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:3156544 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_000612 same experiment
 EMAGE:32022 same embryo
 EMAGE:30080 same embryo
 EMAGE:31526 same embryo
 EMAGE:30186 same embryo
 EMAGE:31832 same embryo
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS