Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:31565

Tmem176a transmembrane protein 176A ( MGI:1913308)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:31565 EMAGE:31565 EMAGE:31565 EMAGE:31565 EMAGE:31565
euxassay_001923_01 euxassay_001923_02 euxassay_001923_03 euxassay_001923_04 euxassay_001923_05
EMAGE:31565 EMAGE:31565 EMAGE:31565 EMAGE:31565 EMAGE:31565
euxassay_001923_06 euxassay_001923_07 euxassay_001923_08 euxassay_001923_09 euxassay_001923_10
EMAGE:31565 EMAGE:31565 EMAGE:31565 EMAGE:31565 EMAGE:31565
euxassay_001923_11 euxassay_001923_12 euxassay_001923_13 euxassay_001923_14 euxassay_001923_15
EMAGE:31565 EMAGE:31565 EMAGE:31565 EMAGE:31565 EMAGE:31565
euxassay_001923_16 euxassay_001923_17 euxassay_001923_18 euxassay_001923_19 euxassay_001923_20

View assay images: EMAGE genex expression entry
Expression pattern clarity: one star
Expression Pattern Description
Text Annotation:
StructureLevelPatternNotes
dorsal root ganglion
moderate moderate
regionalmoderate expression: see section 03 04 09 10 11
meckel's cartilage
moderate moderate
regionalmoderate expression: see section 06 07 16 17 18 weak expression: see section 02 03 04 05 08 13 14 15
submandibular gland primordium
strong strong
regionalstrong expression: see section 04 05 06 12 13 14
thymus primordium
strong strong
regionalstrong expression: see section 09 10 moderate expression: see section 06 07 08
trigeminal v ganglion
weak weak
regionalweak expression: see section 02 03 04 05 15 16 17 18
kidney pelvis
moderate moderate
regionalmoderate expression: see section 05
liver
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 13 weak expression: see section 11 12 14 15 16 17 18 19 20
collecting duct
strong strong
regionalstrong expression: see section 01 15
pituitary gland
moderate moderate
regionalmoderate expression: see section 08 09 10 11 12
kidney calyx
strong strong
regionalstrong expression: see section 04 13 moderate expression: see section 12
lung
moderate moderate
homogeneousmoderate expression: see section 01 02 03 04 05 06 08 09 10 11 12 13 14 15 16 17
glossopharyngeal ix ganglion
weak weak
regionalweak expression: see section 04 05 13
Annotation Validation: text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T700
Entity Detected:Tmem176a, transmembrane protein 176A ( MGI:1913308)
Sequence:sense strand is shown

>T700
TCCTCGAGNCTGTTGGCCTACTGGGTGAGCTCTGGCCTTCCCTGCTGCACACTTCCCCGGTCCCAGAGGA
ATCAGACGATGTCCACAGACATGGAGACTGCAGTCGTCGGCAAGGTGGACCCTGAGGCTCCACAACCCAC
CCACATTGATGTGCACATCCACCAGGAGTCTGCTCTGGCCAAACTTCTGCTGGCCGGATGCTCATTGCTA
AGGATTCCAGCATCCGCTTCCACCCAGAGCCAGGGCAGCAGCAGAGTGCTGGTGGCCTCCTGGGTGGTGC
AGACTGTGCTGGGGGCTCTGAGTGTGGTTCTGGGTGGAACCCTCTACATAGGCCATTATTTAGCCATGTA
TTCCGAAGGCGCCCCCTTCTGGACTGGGATCGTGGCTATGCTGGCTGGAGCTGTTGCCTTCCTTCACAAG
AAACGGGGTGGTACCTGCTGGGCCCTGATGAGGACCCTTCTTGTGCTGGCAAGTTTCTGCACCGCTGTGG
CTGCCATCGTTATTGGGTCTCGTGAGTTGAATTTTTACTGGTATTTTCTCGGAG
Notes:The probe template was PCR amplified from IMAGE:1889276 using vector specific primers. Forward Primer - name:T7-pME18S-FL3-fw, sequence:CGTAATACGACTCACTATAGGGCCTTCTGCTCTAAAAGCTGCG; Reverse Primer - name:T3-pME18S-FL3-rv, sequence:CAAATTAACCCTCACTAAAGGGCGACCTGCAGCTCGAGCAC. Anti-sense probe was then transcribed from the PCR amplified template usi. T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:1889276 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_001923 same experiment
 EMAGE:31839 same embryo
 EMAGE:31399 same embryo
 EMAGE:31870 same embryo
 EMAGE:31766 same embryo
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS